Incidental Mutation 'R0603:Nckap1'
ID55525
Institutional Source Beutler Lab
Gene Symbol Nckap1
Ensembl Gene ENSMUSG00000027002
Gene NameNCK-associated protein 1
Synonymsmh19, Hem-2, Nap1, Hem2, H19
MMRRC Submission 038792-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0603 (G1)
Quality Score114
Status Not validated
Chromosome2
Chromosomal Location80500512-80581380 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 80512729 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 942 (V942E)
Ref Sequence ENSEMBL: ENSMUSP00000107390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028386] [ENSMUST00000111760]
Predicted Effect probably benign
Transcript: ENSMUST00000028386
AA Change: V936E

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000028386
Gene: ENSMUSG00000027002
AA Change: V936E

DomainStartEndE-ValueType
Pfam:Nckap1 8 1124 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111760
AA Change: V942E

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000107390
Gene: ENSMUSG00000027002
AA Change: V942E

DomainStartEndE-ValueType
Pfam:Nckap1 9 1128 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154793
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene exhibit growth arrest at midgestation, an open neural tube, cardia bifida, defective foregut development, defects in endoderm and mesoderm migration and sometimes duplication of the anteroposterior body axis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc7 A G 5: 122,440,170 N406S probably benign Het
Arhgap4 C T X: 73,906,783 R54Q probably damaging Het
Asb15 T A 6: 24,556,557 I17N probably damaging Het
Atp8a1 T C 5: 67,756,696 probably null Het
Caprin1 A G 2: 103,796,801 V47A probably benign Het
Col4a2 T C 8: 11,414,779 V348A probably benign Het
Disp2 A G 2: 118,792,006 K1073R probably damaging Het
Dmxl2 G A 9: 54,405,906 H1686Y possibly damaging Het
Dzank1 C T 2: 144,511,512 V152I probably benign Het
Evl T A 12: 108,648,422 I25N probably damaging Het
Fam117a A G 11: 95,380,873 K424E probably damaging Het
Gm17732 C T 18: 62,662,752 probably benign Het
Gpr158 T C 2: 21,815,669 I659T possibly damaging Het
Hectd4 T A 5: 121,304,337 V1280E possibly damaging Het
Ikbkap A T 4: 56,792,105 I221N possibly damaging Het
Irs4 T C X: 141,725,075 T42A probably damaging Het
Kdm4a C T 4: 118,142,511 V905I probably damaging Het
Lmtk3 T A 7: 45,795,556 probably benign Het
Lsp1 G A 7: 142,489,378 R221H probably damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mut A T 17: 40,947,166 I408F probably damaging Het
Neto1 T A 18: 86,473,660 C229S possibly damaging Het
Nipal2 A G 15: 34,650,398 I63T probably damaging Het
Olfr1299 A T 2: 111,664,880 Y218F probably damaging Het
Olfr366 G A 2: 37,220,106 V206I probably damaging Het
Olfr58 A T 9: 19,783,939 R269W probably damaging Het
Olfr744 T C 14: 50,618,510 I96T probably damaging Het
Olfr957 C A 9: 39,511,514 V69F possibly damaging Het
Pgpep1 T C 8: 70,650,633 E120G probably benign Het
Pkhd1 A T 1: 20,117,173 M3637K probably benign Het
Pkm T C 9: 59,665,881 V58A probably damaging Het
Ppp2r1b C A 9: 50,861,685 T154K probably damaging Het
Rgs18 T A 1: 144,756,080 D98V possibly damaging Het
Rsph6a G T 7: 19,065,961 A506S possibly damaging Het
Selenop T A 15: 3,275,701 V113E probably damaging Het
Slc6a11 G A 6: 114,244,890 V514M probably benign Het
Srsf9 C T 5: 115,332,637 S132L probably damaging Het
Tchh G A 3: 93,443,781 R176H possibly damaging Het
Tcp11 T C 17: 28,067,810 N405S probably damaging Het
Tle1 A C 4: 72,118,347 D760E probably damaging Het
Tmem178 A G 17: 80,945,059 D124G possibly damaging Het
Trabd G A 15: 89,082,726 E118K probably damaging Het
Ttc39a A G 4: 109,426,302 D115G probably damaging Het
Uaca T A 9: 60,871,097 M920K possibly damaging Het
Uba2 A T 7: 34,161,613 M5K probably damaging Het
Unc5c C T 3: 141,771,102 P343L probably damaging Het
Wdhd1 T C 14: 47,263,586 D453G probably damaging Het
Wfdc8 A G 2: 164,603,225 Y157H probably damaging Het
Zbbx T G 3: 75,078,450 K432Q probably benign Het
Zeb2 G A 2: 45,017,426 T169M probably benign Het
Zfp956 A G 6: 47,956,028 E79G probably damaging Het
Zzef1 G A 11: 72,818,069 V165I probably benign Het
Other mutations in Nckap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Nckap1 APN 2 80506202 missense possibly damaging 0.87
IGL00896:Nckap1 APN 2 80580953 missense possibly damaging 0.59
IGL01343:Nckap1 APN 2 80519842 missense possibly damaging 0.81
IGL01593:Nckap1 APN 2 80520570 missense probably benign 0.06
IGL01677:Nckap1 APN 2 80530297 missense probably benign 0.04
IGL01873:Nckap1 APN 2 80553385 missense possibly damaging 0.95
IGL01874:Nckap1 APN 2 80525636 missense probably damaging 1.00
IGL01947:Nckap1 APN 2 80508753 missense probably damaging 1.00
IGL02268:Nckap1 APN 2 80528618 missense probably benign 0.16
IGL02348:Nckap1 APN 2 80517982 missense probably damaging 1.00
IGL03349:Nckap1 APN 2 80525560 missense probably benign 0.07
PIT4151001:Nckap1 UTSW 2 80520370 critical splice donor site probably null
R0326:Nckap1 UTSW 2 80553370 missense probably benign 0.41
R0345:Nckap1 UTSW 2 80544977 splice site probably benign
R0520:Nckap1 UTSW 2 80541530 splice site probably benign
R0924:Nckap1 UTSW 2 80554249 missense probably benign 0.34
R0930:Nckap1 UTSW 2 80554249 missense probably benign 0.34
R0964:Nckap1 UTSW 2 80547899 critical splice donor site probably null
R1122:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1123:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1124:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1125:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1127:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1182:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1234:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1236:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1384:Nckap1 UTSW 2 80533670 missense possibly damaging 0.90
R1402:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1402:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1511:Nckap1 UTSW 2 80553415 missense probably damaging 0.99
R1677:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1686:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1687:Nckap1 UTSW 2 80520585 missense probably damaging 0.96
R1717:Nckap1 UTSW 2 80512670 splice site probably benign
R1789:Nckap1 UTSW 2 80520556 missense probably benign 0.44
R1822:Nckap1 UTSW 2 80517898 missense possibly damaging 0.58
R1840:Nckap1 UTSW 2 80502250 missense possibly damaging 0.88
R1926:Nckap1 UTSW 2 80506838 missense probably damaging 1.00
R1968:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1970:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R2027:Nckap1 UTSW 2 80535518 missense probably damaging 1.00
R2063:Nckap1 UTSW 2 80570150 missense probably damaging 1.00
R2504:Nckap1 UTSW 2 80530218 missense probably benign 0.40
R3824:Nckap1 UTSW 2 80540560 missense possibly damaging 0.72
R4784:Nckap1 UTSW 2 80506934 missense probably benign 0.15
R4908:Nckap1 UTSW 2 80523374 critical splice donor site probably null
R5077:Nckap1 UTSW 2 80548933 missense probably damaging 0.99
R5311:Nckap1 UTSW 2 80540122 missense probably damaging 1.00
R5439:Nckap1 UTSW 2 80512690 missense possibly damaging 0.81
R6141:Nckap1 UTSW 2 80530207 missense probably damaging 1.00
R6209:Nckap1 UTSW 2 80525602 missense probably damaging 1.00
R6226:Nckap1 UTSW 2 80508781 missense possibly damaging 0.96
R6294:Nckap1 UTSW 2 80541514 missense probably benign 0.03
R6458:Nckap1 UTSW 2 80512549 intron probably null
R6937:Nckap1 UTSW 2 80508716 missense probably damaging 1.00
R6986:Nckap1 UTSW 2 80520567 missense probably benign 0.03
R7180:Nckap1 UTSW 2 80506892 missense probably benign 0.01
R7208:Nckap1 UTSW 2 80540198 missense probably benign 0.24
R7363:Nckap1 UTSW 2 80540168 missense probably damaging 1.00
R7448:Nckap1 UTSW 2 80524541 missense probably damaging 1.00
R7513:Nckap1 UTSW 2 80502291 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GAGACATAGTATCCATCCCAGGTAGGC -3'
(R):5'- GGTCATTGGCACAAGAAGCATTGAG -3'

Sequencing Primer
(F):5'- CATGCTATGTTCAGGTTTTACCAG -3'
(R):5'- GAGATGTAAGAAACCATTTCCGC -3'
Posted On2013-07-11