Mutagenetix > Incidental Mutations

Incidental Mutation 'PIT4431001:Dsc2'

555282

Institutional Source

Beutler Lab

Gene Symbol

Dsc2

Ensembl Gene

ENSMUSG00000024331

Gene Name

desmocollin 2

Synonyms

Dsc2b, Dsc2a

Accession Numbers

Genbank: NM_013505; MGI: 103221

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

PIT4431001 (G1)

Quality Score

201.009

Status

Not validated

Chromosome

Chromosomal Location

20030633-20059554 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 20046277 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 245 (Q245*)

Ref Sequence

ENSEMBL: ENSMUSP00000042905 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]

AlphaFold

P55292

Predicted Effect

probably null
Transcript: ENSMUST00000039247
AA Change: Q245*

SMART Domains

Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331
AA Change: Q245*

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000075214
AA Change: Q245*

SMART Domains

Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: Q245*

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC
Pfam:Cadherin_C	730	901	3.7e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000128464

SMART Domains

Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART

Coding Region Coverage

1x: 93.2%
3x: 90.7%
10x: 84.7%
20x: 71.4%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930449I24Rik	A	G	5: 146,502,512	I29V	probably benign	Het
5730455P16Rik	C	A	11: 80,363,924	C357F	probably damaging	Het
Actr1a	A	T	19: 46,382,292		probably null	Het
Adcy1	C	G	11: 7,064,089	Q164E	possibly damaging	Het
Arhgap35	A	T	7: 16,561,611	S1176R	possibly damaging	Het
Atad2b	A	G	12: 5,031,795	T1235A	possibly damaging	Het
Atp8a2	T	C	14: 59,654,626	D1091G	probably benign	Het
Bmp6	T	C	13: 38,485,930	S397P	probably benign	Het
C3	A	T	17: 57,206,242	N1468K	probably benign	Het
Ccnjl	CGCG	CGCGGCG	11: 43,579,707		probably benign	Het
Ccr1	T	C	9: 123,964,194	I100V	probably benign	Het
Cep162	T	A	9: 87,244,345	R171S	probably benign	Het
Chd8	T	C	14: 52,218,249	H994R	probably damaging	Het
Cntn3	T	A	6: 102,464,566	K6N	probably benign	Het
Cope	A	G	8: 70,312,767	E289G	probably damaging	Het
Cpne8	T	G	15: 90,551,975	E279A	probably damaging	Het
Cyp11a1	A	T	9: 58,016,272		probably null	Het
Dcp2	A	G	18: 44,412,571	K333R	probably benign	Het
Dpp6	G	T	5: 27,631,498	V329F	probably benign	Het
Drc1	T	A	5: 30,347,073	D186E	probably damaging	Het
Eef1e1	T	C	13: 38,658,962	E11G	probably damaging	Het
Emilin2	G	A	17: 71,255,995	P915S	probably benign	Het
Fam214b	C	A	4: 43,036,024	G236C	probably damaging	Het
Fpgt	A	G	3: 155,086,785	M535T	possibly damaging	Het
Fxyd3	G	A	7: 31,071,355	L37F	probably damaging	Het
Gal3st2c	T	A	1: 94,008,112	I62N	probably damaging	Het
Gdpd3	T	C	7: 126,766,475	I2T	probably benign	Het
Gm9611	T	C	14: 42,293,931	M169V		Het
Ints3	G	A	3: 90,396,460	T720I	probably damaging	Het
Itpr2	T	G	6: 146,354,720	M992L	probably benign	Het
L3mbtl2	T	A	15: 81,676,307	H256Q	probably benign	Het
Lama2	T	C	10: 27,101,430	T1918A	probably damaging	Het
Lpcat2b	G	A	5: 107,434,131	G442D	probably damaging	Het
Lrp1b	C	T	2: 41,004,755	V2268M		Het
Macc1	T	C	12: 119,446,511	L338P	probably benign	Het
Mtmr2	T	C	9: 13,793,179	F201L	probably benign	Het
Mtr	C	T	13: 12,212,443	V772M	probably damaging	Het
Mtus2	A	G	5: 148,076,705	T103A	probably benign	Het
Myo5c	A	G	9: 75,252,571	I294V	possibly damaging	Het
Ncam1	A	T	9: 49,798,693	F13I	probably benign	Het
Olfr1248	T	C	2: 89,617,857	I112V	probably benign	Het
Paqr6	A	T	3: 88,365,777	I52F	possibly damaging	Het
Pde2a	T	G	7: 101,501,897	V271G	probably damaging	Het
Pde7b	T	C	10: 20,400,545	H405R	possibly damaging	Het
Plxnb1	A	G	9: 109,100,718	Y214C	probably damaging	Het
Pmp22	T	C	11: 63,151,241	F101L	probably benign	Het
Pold1	A	G	7: 44,538,894	L520P	probably damaging	Het
Pramel1	A	G	4: 143,398,390	T295A	possibly damaging	Het
Psg20	A	T	7: 18,674,550	I415N	probably damaging	Het
Ptcd2	T	A	13: 99,340,019	R71*	probably null	Het
Ptgs1	A	T	2: 36,240,680	N197I	probably damaging	Het
Rbfox3	T	C	11: 118,495,221	D333G	probably damaging	Het
Rfx7	T	A	9: 72,617,971	H814Q	probably benign	Het
Rptn	TGGGTCAGAAAGGCAGGCATGACCAGAGTCCTCACCAGGGTCAGAAAGGCAGGCATGACCAGAGTCCTCACCAGGGTCAGAAAGGCAGACAAGACCTGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTCCTCACCTGGGTCAGAAAGGCAGGCATGACCAGAGTCCTCACCGGGGTCAGAAAGGCAGGCAAGACCAGAGTCCTCACCAGGGTCAGAAAGGCAG	TGGGTCAGAAAGGCAGGCATGACCAGAGTCCTCACCAGGGTCAGAAAGGCAGACAAGACCTGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTCCTCACCTGGGTCAGAAAGGCAGGCATGACCAGAGTCCTCACCGGGGTCAGAAAGGCAGGCAAGACCAGAGTCCTCACCAGGGTCAGAAAGGCAG	3: 93,397,397		probably benign	Het
Serpina3i	A	T	12: 104,265,173	H23L	probably benign	Het
Sipa1l1	T	A	12: 82,396,516	V860E	probably benign	Het
Slc12a1	T	A	2: 125,190,204	Y592N	possibly damaging	Het
Slco2a1	T	C	9: 103,050,268	F120S	probably damaging	Het
Smyd4	T	C	11: 75,403,513	F740S	probably damaging	Het
Sppl2a	T	C	2: 126,923,476	Y242C	probably damaging	Het
Sqle	A	G	15: 59,323,660	K288R	probably benign	Het
Tbc1d17	A	G	7: 44,845,074	S246P	probably benign	Het
Tenm3	G	A	8: 48,235,607	T2315M	probably damaging	Het
Tgfb1i1	C	T	7: 128,249,181	R191C	probably damaging	Het
Thumpd3	T	A	6: 113,059,978	N279K	probably benign	Het
Tmed5	T	A	5: 108,130,021	H95L	possibly damaging	Het
Tmem161a	T	C	8: 70,182,024	L443P	probably damaging	Het
Ttc38	C	A	15: 85,836,127	Q97K	probably benign	Het
Unc13c	C	A	9: 73,749,547	C1124F	probably damaging	Het
Vmn2r102	A	G	17: 19,676,696	T102A	possibly damaging	Het
Vwce	G	A	19: 10,664,582	E891K	possibly damaging	Het
Xkr5	A	T	8: 18,934,345	S394T	possibly damaging	Het
Zan	C	T	5: 137,392,064	C4747Y	unknown	Het
Zfp804a	T	C	2: 82,259,192	F1122L	probably benign	Het

Other mutations in Dsc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00802:Dsc2	APN	18	20041797	missense	probably benign	0.01
IGL00826:Dsc2	APN	18	20035315	missense	probably damaging	1.00
IGL00852:Dsc2	APN	18	20034683	missense	probably benign	0.01
IGL01082:Dsc2	APN	18	20043792	missense	probably damaging	1.00
IGL01328:Dsc2	APN	18	20048286	missense	probably damaging	0.98
IGL01338:Dsc2	APN	18	20047157	missense	probably benign	0.19
IGL01727:Dsc2	APN	18	20038200	missense	probably benign	0.01
IGL01766:Dsc2	APN	18	20046342	missense	possibly damaging	0.56
IGL02228:Dsc2	APN	18	20043733	missense	probably damaging	0.99
IGL02560:Dsc2	APN	18	20045539	missense	probably damaging	1.00
IGL02794:Dsc2	APN	18	20041731	missense	probably damaging	1.00
3-1:Dsc2	UTSW	18	20047079	missense	possibly damaging	0.60
PIT4305001:Dsc2	UTSW	18	20046243	missense	probably damaging	0.96
R0288:Dsc2	UTSW	18	20033120	missense	probably damaging	1.00
R0542:Dsc2	UTSW	18	20051226	missense	probably damaging	0.99
R0562:Dsc2	UTSW	18	20041537	missense	probably damaging	0.99
R0697:Dsc2	UTSW	18	20041452	missense	probably damaging	0.99
R0940:Dsc2	UTSW	18	20050059	missense	probably damaging	0.97
R1081:Dsc2	UTSW	18	20033295	missense	probably damaging	0.96
R1140:Dsc2	UTSW	18	20032212	missense	probably damaging	1.00
R1515:Dsc2	UTSW	18	20034701	missense	probably damaging	0.99
R1515:Dsc2	UTSW	18	20045565	missense	probably benign	0.40
R1558:Dsc2	UTSW	18	20050151	missense	probably damaging	0.99
R1654:Dsc2	UTSW	18	20046246	missense	probably benign	0.01
R2061:Dsc2	UTSW	18	20032399	missense	possibly damaging	0.79
R2089:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2172:Dsc2	UTSW	18	20045502	missense	probably damaging	1.00
R2247:Dsc2	UTSW	18	20035312	missense	probably damaging	1.00
R2472:Dsc2	UTSW	18	20045469	missense	probably benign	0.00
R2927:Dsc2	UTSW	18	20045501	missense	probably damaging	1.00
R3611:Dsc2	UTSW	18	20032351	missense	probably damaging	0.99
R3961:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R3963:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R4353:Dsc2	UTSW	18	20050068	missense	probably damaging	1.00
R4362:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R4612:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4613:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4752:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R4946:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R5056:Dsc2	UTSW	18	20050142	missense	probably damaging	1.00
R5267:Dsc2	UTSW	18	20034583	critical splice donor site	probably null
R5445:Dsc2	UTSW	18	20035303	missense	possibly damaging	0.76
R5507:Dsc2	UTSW	18	20046279	missense	probably damaging	0.96
R5575:Dsc2	UTSW	18	20035390	missense	probably damaging	1.00
R5781:Dsc2	UTSW	18	20032510	missense	probably benign	0.00
R6102:Dsc2	UTSW	18	20047108	missense	probably benign	0.01
R6129:Dsc2	UTSW	18	20045430	missense	possibly damaging	0.95
R6362:Dsc2	UTSW	18	20035463	nonsense	probably null
R6433:Dsc2	UTSW	18	20051175	critical splice donor site	probably null
R6513:Dsc2	UTSW	18	20046238	missense	probably benign
R6615:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.88
R6619:Dsc2	UTSW	18	20032278	missense	probably benign	0.22
R6665:Dsc2	UTSW	18	20050148	missense	probably damaging	1.00
R6961:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R7179:Dsc2	UTSW	18	20035275	critical splice donor site	probably null
R7275:Dsc2	UTSW	18	20051179	nonsense	probably null
R7352:Dsc2	UTSW	18	20035335	missense	probably benign	0.39
R7386:Dsc2	UTSW	18	20041926	missense	possibly damaging	0.84
R7496:Dsc2	UTSW	18	20035394	nonsense	probably null
R7510:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R7580:Dsc2	UTSW	18	20050073	missense	probably damaging	1.00
R7718:Dsc2	UTSW	18	20041778	missense	probably damaging	0.98
R7733:Dsc2	UTSW	18	20048315	missense	probably benign	0.00
R7733:Dsc2	UTSW	18	20048316	missense	probably benign	0.16
R7818:Dsc2	UTSW	18	20050132	missense	probably damaging	1.00
R7852:Dsc2	UTSW	18	20046285	missense	possibly damaging	0.67
R7998:Dsc2	UTSW	18	20034663	missense	possibly damaging	0.87
R8029:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8030:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8031:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8032:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8059:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8060:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8061:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8062:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8063:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8082:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8090:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8114:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8115:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8116:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8117:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8118:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8328:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.68
R8545:Dsc2	UTSW	18	20034665	nonsense	probably null
R9005:Dsc2	UTSW	18	20038094	missense	probably benign	0.00
R9017:Dsc2	UTSW	18	20043911	missense	probably damaging	1.00
R9111:Dsc2	UTSW	18	20034707	missense	probably benign	0.00
R9396:Dsc2	UTSW	18	20041716	nonsense	probably null
Z1088:Dsc2	UTSW	18	20046304	missense	probably damaging	0.98
Z1176:Dsc2	UTSW	18	20035299	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCTACAGATAACCCATTGGCTG -3'
(R):5'- TGAATTCCATTCCCAGCACC -3'

Sequencing Primer
(F):5'- CGTTGTCAAACCAAGAAACCGG -3'
(R):5'- TTCCATTCCCAGCACCACAAAAG -3'

Posted On

2019-06-07