Incidental Mutation 'PIT4453001:Abca4'
ID555296
Institutional Source Beutler Lab
Gene Symbol Abca4
Ensembl Gene ENSMUSG00000028125
Gene NameATP-binding cassette, sub-family A (ABC1), member 4
SynonymsD430003I15Rik, Abc10, Rim protein, RmP
Accession Numbers

Genbank: NM_007378; MGI: 109424

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4453001 (G1)
Quality Score119.008
Status Not validated
Chromosome3
Chromosomal Location122044443-122180123 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 122105316 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 649 (I649S)
Ref Sequence ENSEMBL: ENSMUSP00000013995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013995]
Predicted Effect probably damaging
Transcript: ENSMUST00000013995
AA Change: I649S

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000013995
Gene: ENSMUSG00000028125
AA Change: I649S

DomainStartEndE-ValueType
transmembrane domain 23 42 N/A INTRINSIC
Pfam:ABC2_membrane_3 608 856 5e-17 PFAM
AAA 955 1145 9.42e-13 SMART
transmembrane domain 1372 1394 N/A INTRINSIC
Pfam:ABC2_membrane_3 1522 1894 2.9e-44 PFAM
AAA 1963 2147 7.09e-8 SMART
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.9%
  • 10x: 85.6%
  • 20x: 74.1%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein was the first of the ABC transporters to be observed in photoreceptors and may play a role in the photoresponse. Mutations in the human gene are found in patients diagnosed with Stargardt disease and are associated with retinitis pigmentosa-19 and macular degeneration age-related 2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display delayed rod dark adaptation and are a model for juvenile macular degeneration. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T A 19: 43,803,782 L334* probably null Het
Adam28 A T 14: 68,634,876 S306T probably benign Het
Adam34 T A 8: 43,651,312 D432V probably damaging Het
Adcy7 A G 8: 88,323,636 Y723C probably benign Het
Adgre5 T A 8: 83,724,460 M713L probably benign Het
Aebp2 C A 6: 140,637,686 C295* probably null Het
Amn1 G T 6: 149,170,859 Q127K probably benign Het
Atcay C T 10: 81,210,549 V314M probably damaging Het
Atp1a1 T C 3: 101,581,179 E847G probably benign Het
Atp2b1 A G 10: 99,016,978 E1039G probably benign Het
Caskin1 A G 17: 24,499,292 Y292C probably damaging Het
Cftr A G 6: 18,214,106 T94A probably damaging Het
Ciart T A 3: 95,880,476 K182M probably damaging Het
Col1a2 A C 6: 4,527,079 S603R possibly damaging Het
Cspp1 C A 1: 10,074,872 S298R possibly damaging Het
Cul7 T A 17: 46,651,820 C126S probably damaging Het
Cyp2c55 A T 19: 39,011,791 I145F probably damaging Het
Cypt4 G C 9: 24,625,474 A87P probably damaging Het
Disp2 G A 2: 118,787,644 V224M probably benign Het
Dlgap5 TTC T 14: 47,401,522 probably null Het
Dock1 A G 7: 135,152,300 K1602R probably benign Het
Ears2 T C 7: 122,048,339 I241V probably benign Het
Eml6 T C 11: 29,802,489 T975A probably damaging Het
Ephb2 T C 4: 136,660,810 T660A probably benign Het
Fbxw7 G A 3: 84,965,314 V268M Het
Gart A G 16: 91,636,538 F289S probably damaging Het
Gmcl1 G T 6: 86,704,538 N391K probably benign Het
Greb1l A C 18: 10,533,031 Q975P probably damaging Het
Greb1l G T 18: 10,533,032 Q975H probably benign Het
Grik5 C A 7: 25,010,694 R872L probably damaging Het
Hmox2 T A 16: 4,765,057 I218N probably damaging Het
Hook1 A T 4: 96,014,852 D526V probably damaging Het
Ifna4 A T 4: 88,841,954 N32Y probably damaging Het
Ighg2b T A 12: 113,306,872 N213Y unknown Het
Itih4 G A 14: 30,901,170 V900I probably benign Het
Itpr2 A T 6: 146,373,173 F837Y probably damaging Het
Kif3a T C 11: 53,579,114 V147A probably benign Het
Klra9 T A 6: 130,191,321 probably benign Het
Lamp3 G T 16: 19,673,460 Q345K probably benign Het
Ltbp3 G A 19: 5,757,794 E1188K probably damaging Het
Med1 T A 11: 98,158,417 I518L probably benign Het
Mis18bp1 T C 12: 65,158,673 T242A probably damaging Het
Nemp1 T A 10: 127,696,254 F392Y probably benign Het
Obscn C A 11: 59,060,976 G3984W probably damaging Het
Obscn T A 11: 59,069,834 H3217L possibly damaging Het
Olfr1157 C T 2: 87,962,458 V145M possibly damaging Het
Olfr1328 A G 4: 118,934,626 M74T probably benign Het
Olfr1532-ps1 C T 7: 106,914,929 H244Y probably damaging Het
Olfr709-ps1 T C 7: 106,926,842 I206V probably benign Het
Olfr71 A G 4: 43,706,464 Y35H probably damaging Het
P4ha1 G T 10: 59,350,472 A258S probably benign Het
Parn T C 16: 13,607,281 I423V probably benign Het
Pcdh20 C A 14: 88,467,308 S852I probably damaging Het
Pcnx3 A G 19: 5,672,756 probably null Het
Pcsk1 A T 13: 75,112,650 I331F probably damaging Het
Pkd1l2 G T 8: 117,022,022 S1803R probably benign Het
Pkd1l3 C A 8: 109,660,801 N1792K probably damaging Het
Plekhg1 C A 10: 3,963,469 Q1119K Het
Prr30 T A 14: 101,198,935 T64S probably benign Het
Rec114 T C 9: 58,660,370 N111S probably benign Het
Reck G A 4: 43,895,850 V79I probably benign Het
Rexo1 A G 10: 80,550,397 F276L probably damaging Het
Rgs6 T C 12: 83,091,779 Y296H probably damaging Het
Sdk1 A G 5: 142,212,038 R2149G probably benign Het
Slc20a2 C A 8: 22,535,382 F33L probably damaging Het
Spopl T A 2: 23,545,449 T25S probably damaging Het
Srcap A T 7: 127,549,320 I1947F possibly damaging Het
Srek1 A C 13: 103,744,783 probably null Het
St8sia1 C T 6: 142,829,252 W200* probably null Het
Tas2r106 A T 6: 131,678,502 F129I possibly damaging Het
Tbrg4 A T 11: 6,620,857 L205Q probably damaging Het
Tchh C A 3: 93,445,880 R876S unknown Het
Thap12 G T 7: 98,715,038 A138S probably benign Het
Tjp1 C T 7: 65,343,614 probably null Het
Traf4 G A 11: 78,161,534 P95L probably benign Het
Trappc9 ATCTC ATCTCTC 15: 73,031,598 probably null Het
Usp20 G A 2: 31,017,486 V677M possibly damaging Het
Usp50 C A 2: 126,783,316 probably benign Het
Vmn1r21 T C 6: 57,844,322 T46A probably benign Het
Vmn2r54 T A 7: 12,629,742 H408L probably benign Het
Zfp266 T C 9: 20,506,003 T30A probably benign Het
Zfp536 T C 7: 37,479,757 H1141R probably benign Het
Other mutations in Abca4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Abca4 APN 3 122062704 splice site probably null
IGL00229:Abca4 APN 3 122170954 missense probably damaging 1.00
IGL00858:Abca4 APN 3 122173888 missense probably damaging 0.97
IGL01316:Abca4 APN 3 122141755 missense probably damaging 0.99
IGL01357:Abca4 APN 3 122103583 missense probably damaging 1.00
IGL01784:Abca4 APN 3 122138505 missense probably benign 0.22
IGL01903:Abca4 APN 3 122155401 splice site probably benign
IGL02008:Abca4 APN 3 122176101 missense probably benign 0.00
IGL02113:Abca4 APN 3 122110478 missense possibly damaging 0.90
IGL02142:Abca4 APN 3 122169926 missense probably benign 0.01
IGL02200:Abca4 APN 3 122069014 missense probably benign 0.00
IGL02203:Abca4 APN 3 122179808 missense probably benign
IGL02306:Abca4 APN 3 122158395 missense probably damaging 1.00
IGL02307:Abca4 APN 3 122141746 missense probably damaging 1.00
IGL02673:Abca4 APN 3 122103501 missense probably damaging 1.00
IGL02864:Abca4 APN 3 122143431 missense probably damaging 1.00
IGL02886:Abca4 APN 3 122128214 missense probably damaging 0.96
IGL02934:Abca4 APN 3 122162359 nonsense probably null
IGL02992:Abca4 APN 3 122128286 missense probably damaging 0.96
IGL03083:Abca4 APN 3 122138612 critical splice donor site probably null
IGL03258:Abca4 APN 3 122137561 splice site probably benign
IGL03279:Abca4 APN 3 122141732 missense probably benign 0.12
3-1:Abca4 UTSW 3 122080925 missense probably benign 0.01
B6819:Abca4 UTSW 3 122103624 splice site probably benign
K7894:Abca4 UTSW 3 122147868 frame shift probably null
PIT4151001:Abca4 UTSW 3 122137021 missense probably damaging 0.99
R0001:Abca4 UTSW 3 122081011 splice site probably benign
R0091:Abca4 UTSW 3 122138530 missense possibly damaging 0.94
R0138:Abca4 UTSW 3 122105449 missense probably damaging 1.00
R0344:Abca4 UTSW 3 122083964 missense probably damaging 1.00
R0347:Abca4 UTSW 3 122120099 missense probably benign 0.00
R0508:Abca4 UTSW 3 122123551 splice site probably benign
R0607:Abca4 UTSW 3 122156432 missense probably damaging 1.00
R0835:Abca4 UTSW 3 122126213 missense probably damaging 1.00
R0839:Abca4 UTSW 3 122126878 missense probably damaging 0.99
R1138:Abca4 UTSW 3 122173848 missense probably benign 0.13
R1448:Abca4 UTSW 3 122162928 splice site probably null
R1453:Abca4 UTSW 3 122069114 missense probably benign 0.04
R1533:Abca4 UTSW 3 122135158 missense probably benign 0.07
R1645:Abca4 UTSW 3 122155277 missense probably benign 0.00
R1763:Abca4 UTSW 3 122110681 missense probably benign 0.09
R1763:Abca4 UTSW 3 122163830 missense probably damaging 1.00
R1838:Abca4 UTSW 3 122128305 missense probably benign
R1867:Abca4 UTSW 3 122105361 missense probably damaging 1.00
R1907:Abca4 UTSW 3 122069012 missense probably damaging 0.99
R1935:Abca4 UTSW 3 122052923 missense probably benign 0.00
R1936:Abca4 UTSW 3 122052923 missense probably benign 0.00
R2165:Abca4 UTSW 3 122112399 missense possibly damaging 0.90
R2391:Abca4 UTSW 3 122158422 missense probably benign 0.00
R2403:Abca4 UTSW 3 122170943 missense probably damaging 1.00
R3788:Abca4 UTSW 3 122052912 missense possibly damaging 0.50
R3814:Abca4 UTSW 3 122170921 splice site probably benign
R4554:Abca4 UTSW 3 122156343 missense possibly damaging 0.91
R4649:Abca4 UTSW 3 122169893 missense probably damaging 1.00
R4653:Abca4 UTSW 3 122138581 nonsense probably null
R4655:Abca4 UTSW 3 122147498 missense possibly damaging 0.93
R4668:Abca4 UTSW 3 122155299 missense possibly damaging 0.90
R4705:Abca4 UTSW 3 122105370 missense probably damaging 0.98
R4788:Abca4 UTSW 3 122166712 missense probably damaging 1.00
R4795:Abca4 UTSW 3 122176123 missense probably damaging 0.99
R4999:Abca4 UTSW 3 122105370 missense probably damaging 1.00
R5301:Abca4 UTSW 3 122102853 missense probably damaging 0.96
R5372:Abca4 UTSW 3 122055339 missense probably damaging 0.96
R5395:Abca4 UTSW 3 122080941 missense probably benign 0.00
R5539:Abca4 UTSW 3 122169908 missense probably damaging 1.00
R5583:Abca4 UTSW 3 122148901 missense probably damaging 0.99
R5706:Abca4 UTSW 3 122054261 missense probably benign 0.10
R5719:Abca4 UTSW 3 122135266 critical splice donor site probably null
R5731:Abca4 UTSW 3 122132593 missense probably damaging 1.00
R5802:Abca4 UTSW 3 122054232 missense probably damaging 1.00
R5819:Abca4 UTSW 3 122136981 missense probably damaging 0.97
R5853:Abca4 UTSW 3 122103531 missense probably benign
R6053:Abca4 UTSW 3 122171017 missense probably damaging 0.99
R6135:Abca4 UTSW 3 122138447 missense possibly damaging 0.69
R6185:Abca4 UTSW 3 122126140 missense probably damaging 0.97
R6227:Abca4 UTSW 3 122137094 nonsense probably null
R6293:Abca4 UTSW 3 122141746 missense probably damaging 1.00
R6297:Abca4 UTSW 3 122132530 missense probably benign 0.24
R6367:Abca4 UTSW 3 122103580 missense probably damaging 1.00
R6376:Abca4 UTSW 3 122123660 missense possibly damaging 0.95
R6405:Abca4 UTSW 3 122173662 splice site probably null
R6525:Abca4 UTSW 3 122137659 missense probably benign 0.00
R6602:Abca4 UTSW 3 122138501 missense probably benign 0.00
R6681:Abca4 UTSW 3 122121798 missense probably damaging 1.00
R6747:Abca4 UTSW 3 122126313 splice site probably null
R6852:Abca4 UTSW 3 122135195 missense probably damaging 0.99
R7049:Abca4 UTSW 3 122147848 missense probably benign 0.00
R7072:Abca4 UTSW 3 122173943 missense probably damaging 1.00
R7092:Abca4 UTSW 3 122138569 missense probably damaging 1.00
R7110:Abca4 UTSW 3 122132643 missense probably damaging 1.00
R7138:Abca4 UTSW 3 122105464 nonsense probably null
R7172:Abca4 UTSW 3 122103540 nonsense probably null
R7263:Abca4 UTSW 3 122054194 missense probably damaging 0.99
R7414:Abca4 UTSW 3 122102738 missense probably benign 0.28
R7537:Abca4 UTSW 3 122173988 missense possibly damaging 0.68
R7577:Abca4 UTSW 3 122174014 missense probably damaging 1.00
R7665:Abca4 UTSW 3 122044490 start gained probably benign
R7758:Abca4 UTSW 3 122128167 missense probably damaging 1.00
R7935:Abca4 UTSW 3 122110537 missense possibly damaging 0.85
R8237:Abca4 UTSW 3 122162303 missense probably benign 0.00
R8255:Abca4 UTSW 3 122155277 missense probably benign 0.00
R8294:Abca4 UTSW 3 122103568 missense possibly damaging 0.75
R8504:Abca4 UTSW 3 122129334 missense probably benign 0.01
R8536:Abca4 UTSW 3 122179745 missense probably benign 0.01
Z1176:Abca4 UTSW 3 122103488 missense probably damaging 1.00
Z1176:Abca4 UTSW 3 122156443 missense probably damaging 1.00
Z1177:Abca4 UTSW 3 122147786 missense possibly damaging 0.79
Z1177:Abca4 UTSW 3 122173914 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- GTCCAGAACGGCTCCATTTTG -3'
(R):5'- TCAGCGCCATGATGGAGAAG -3'

Sequencing Primer
(F):5'- GAACGGCTCCATTTTGCCTTAAAG -3'
(R):5'- CGCCATGATGGAGAAGCTATCC -3'
Posted On2019-06-07