Incidental Mutation 'PIT4453001:Or13j1'
ID 555297
Institutional Source Beutler Lab
Gene Symbol Or13j1
Ensembl Gene ENSMUSG00000046450
Gene Name olfactory receptor family 13 subfamily J member 1
Synonyms MOR262-4, Olfr71, mOR17, GA_x6K02T2N78B-16230286-16231224
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # PIT4453001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 43705628-43706566 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 43706464 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 35 (Y35H)
Ref Sequence ENSEMBL: ENSMUSP00000103494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055401] [ENSMUST00000107862] [ENSMUST00000217544]
AlphaFold Q9QZ18
Predicted Effect probably damaging
Transcript: ENSMUST00000055401
AA Change: Y35H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060230
Gene: ENSMUSG00000046450
AA Change: Y35H

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 2.4e-34 PFAM
Pfam:7tm_4 139 283 4.5e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107862
AA Change: Y35H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103494
Gene: ENSMUSG00000046450
AA Change: Y35H

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 2.2e-52 PFAM
Pfam:7tm_1 41 290 7.5e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217544
AA Change: Y35H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.9%
  • 10x: 85.6%
  • 20x: 74.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T G 3: 121,898,965 (GRCm39) I649S probably damaging Het
Abcc2 T A 19: 43,792,221 (GRCm39) L334* probably null Het
Adam28 A T 14: 68,872,325 (GRCm39) S306T probably benign Het
Adam34 T A 8: 44,104,349 (GRCm39) D432V probably damaging Het
Adcy7 A G 8: 89,050,264 (GRCm39) Y723C probably benign Het
Adgre5 T A 8: 84,451,089 (GRCm39) M713L probably benign Het
Aebp2 C A 6: 140,583,412 (GRCm39) C295* probably null Het
Amn1 G T 6: 149,072,357 (GRCm39) Q127K probably benign Het
Atcay C T 10: 81,046,383 (GRCm39) V314M probably damaging Het
Atp1a1 T C 3: 101,488,495 (GRCm39) E847G probably benign Het
Atp2b1 A G 10: 98,852,840 (GRCm39) E1039G probably benign Het
Caskin1 A G 17: 24,718,266 (GRCm39) Y292C probably damaging Het
Cftr A G 6: 18,214,105 (GRCm39) T94A probably damaging Het
Ciart T A 3: 95,787,788 (GRCm39) K182M probably damaging Het
Col1a2 A C 6: 4,527,079 (GRCm39) S603R possibly damaging Het
Cspp1 C A 1: 10,145,097 (GRCm39) S298R possibly damaging Het
Cul7 T A 17: 46,962,746 (GRCm39) C126S probably damaging Het
Cyp2c55 A T 19: 39,000,235 (GRCm39) I145F probably damaging Het
Cypt4 G C 9: 24,536,770 (GRCm39) A87P probably damaging Het
Disp2 G A 2: 118,618,125 (GRCm39) V224M probably benign Het
Dlgap5 TTC T 14: 47,638,979 (GRCm39) probably null Het
Dock1 A G 7: 134,754,029 (GRCm39) K1602R probably benign Het
Ears2 T C 7: 121,647,562 (GRCm39) I241V probably benign Het
Eml6 T C 11: 29,752,489 (GRCm39) T975A probably damaging Het
Ephb2 T C 4: 136,388,121 (GRCm39) T660A probably benign Het
Fbxw7 G A 3: 84,872,621 (GRCm39) V268M Het
Gart A G 16: 91,433,426 (GRCm39) F289S probably damaging Het
Gmcl1 G T 6: 86,681,520 (GRCm39) N391K probably benign Het
Greb1l A C 18: 10,533,031 (GRCm39) Q975P probably damaging Het
Greb1l G T 18: 10,533,032 (GRCm39) Q975H probably benign Het
Grik5 C A 7: 24,710,119 (GRCm39) R872L probably damaging Het
Hmox2 T A 16: 4,582,921 (GRCm39) I218N probably damaging Het
Hook1 A T 4: 95,903,089 (GRCm39) D526V probably damaging Het
Ifna4 A T 4: 88,760,191 (GRCm39) N32Y probably damaging Het
Ighg2b T A 12: 113,270,492 (GRCm39) N213Y unknown Het
Itih4 G A 14: 30,623,127 (GRCm39) V900I probably benign Het
Itpr2 A T 6: 146,274,671 (GRCm39) F837Y probably damaging Het
Kif3a T C 11: 53,469,941 (GRCm39) V147A probably benign Het
Klra9 T A 6: 130,168,284 (GRCm39) probably benign Het
Lamp3 G T 16: 19,492,210 (GRCm39) Q345K probably benign Het
Ltbp3 G A 19: 5,807,822 (GRCm39) E1188K probably damaging Het
Med1 T A 11: 98,049,243 (GRCm39) I518L probably benign Het
Mis18bp1 T C 12: 65,205,447 (GRCm39) T242A probably damaging Het
Nemp1 T A 10: 127,532,123 (GRCm39) F392Y probably benign Het
Obscn C A 11: 58,951,802 (GRCm39) G3984W probably damaging Het
Obscn T A 11: 58,960,660 (GRCm39) H3217L possibly damaging Het
Or10ak7 A G 4: 118,791,823 (GRCm39) M74T probably benign Het
Or2d3b C T 7: 106,514,136 (GRCm39) H244Y probably damaging Het
Or2d3c T C 7: 106,526,049 (GRCm39) I206V probably benign Het
Or5l14 C T 2: 87,792,802 (GRCm39) V145M possibly damaging Het
P4ha1 G T 10: 59,186,294 (GRCm39) A258S probably benign Het
Parn T C 16: 13,425,145 (GRCm39) I423V probably benign Het
Pcdh20 C A 14: 88,704,744 (GRCm39) S852I probably damaging Het
Pcnx3 A G 19: 5,722,784 (GRCm39) probably null Het
Pcsk1 A T 13: 75,260,769 (GRCm39) I331F probably damaging Het
Pkd1l2 G T 8: 117,748,761 (GRCm39) S1803R probably benign Het
Pkd1l3 C A 8: 110,387,433 (GRCm39) N1792K probably damaging Het
Plekhg1 C A 10: 3,913,469 (GRCm39) Q1119K Het
Prr30 T A 14: 101,436,371 (GRCm39) T64S probably benign Het
Rec114 T C 9: 58,567,653 (GRCm39) N111S probably benign Het
Reck G A 4: 43,895,850 (GRCm39) V79I probably benign Het
Rexo1 A G 10: 80,386,231 (GRCm39) F276L probably damaging Het
Rgs6 T C 12: 83,138,553 (GRCm39) Y296H probably damaging Het
Sdk1 A G 5: 142,197,793 (GRCm39) R2149G probably benign Het
Slc20a2 C A 8: 23,025,398 (GRCm39) F33L probably damaging Het
Spopl T A 2: 23,435,461 (GRCm39) T25S probably damaging Het
Srcap A T 7: 127,148,492 (GRCm39) I1947F possibly damaging Het
Srek1 A C 13: 103,881,291 (GRCm39) probably null Het
St8sia1 C T 6: 142,774,978 (GRCm39) W200* probably null Het
Tas2r106 A T 6: 131,655,465 (GRCm39) F129I possibly damaging Het
Tbrg4 A T 11: 6,570,857 (GRCm39) L205Q probably damaging Het
Tchh C A 3: 93,353,187 (GRCm39) R876S unknown Het
Thap12 G T 7: 98,364,245 (GRCm39) A138S probably benign Het
Tjp1 C T 7: 64,993,362 (GRCm39) probably null Het
Traf4 G A 11: 78,052,360 (GRCm39) P95L probably benign Het
Trappc9 ATCTC ATCTCTC 15: 72,903,447 (GRCm39) probably null Het
Usp20 G A 2: 30,907,498 (GRCm39) V677M possibly damaging Het
Usp50 C A 2: 126,625,236 (GRCm39) probably benign Het
Vmn1r21 T C 6: 57,821,307 (GRCm39) T46A probably benign Het
Vmn2r54 T A 7: 12,363,669 (GRCm39) H408L probably benign Het
Zfp266 T C 9: 20,417,299 (GRCm39) T30A probably benign Het
Zfp536 T C 7: 37,179,182 (GRCm39) H1141R probably benign Het
Other mutations in Or13j1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02317:Or13j1 APN 4 43,706,172 (GRCm39) missense probably damaging 1.00
R0597:Or13j1 UTSW 4 43,706,592 (GRCm39) splice site probably null
R0610:Or13j1 UTSW 4 43,706,400 (GRCm39) missense possibly damaging 0.69
R1588:Or13j1 UTSW 4 43,705,923 (GRCm39) missense probably damaging 0.98
R1619:Or13j1 UTSW 4 43,706,292 (GRCm39) missense probably damaging 1.00
R1779:Or13j1 UTSW 4 43,706,041 (GRCm39) missense probably damaging 1.00
R2871:Or13j1 UTSW 4 43,706,458 (GRCm39) missense probably benign 0.30
R2871:Or13j1 UTSW 4 43,706,458 (GRCm39) missense probably benign 0.30
R4723:Or13j1 UTSW 4 43,705,785 (GRCm39) missense probably damaging 1.00
R4891:Or13j1 UTSW 4 43,706,194 (GRCm39) missense probably damaging 0.99
R5049:Or13j1 UTSW 4 43,706,259 (GRCm39) missense probably damaging 1.00
R5151:Or13j1 UTSW 4 43,706,518 (GRCm39) missense probably damaging 0.99
R5491:Or13j1 UTSW 4 43,705,990 (GRCm39) missense probably damaging 1.00
R5521:Or13j1 UTSW 4 43,705,788 (GRCm39) missense possibly damaging 0.88
R6225:Or13j1 UTSW 4 43,705,698 (GRCm39) missense probably damaging 1.00
R6518:Or13j1 UTSW 4 43,706,334 (GRCm39) missense probably benign 0.05
R6883:Or13j1 UTSW 4 43,705,723 (GRCm39) missense possibly damaging 0.93
R7185:Or13j1 UTSW 4 43,706,082 (GRCm39) missense possibly damaging 0.82
R7339:Or13j1 UTSW 4 43,706,080 (GRCm39) missense probably benign 0.05
R7502:Or13j1 UTSW 4 43,706,316 (GRCm39) missense probably damaging 0.97
R8052:Or13j1 UTSW 4 43,705,884 (GRCm39) missense probably damaging 0.97
R8797:Or13j1 UTSW 4 43,706,455 (GRCm39) missense probably damaging 1.00
R9701:Or13j1 UTSW 4 43,705,793 (GRCm39) missense probably benign 0.00
X0017:Or13j1 UTSW 4 43,705,990 (GRCm39) missense probably damaging 1.00
X0021:Or13j1 UTSW 4 43,706,326 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGGAGAGGCTCAGACACATC -3'
(R):5'- GAAAAGACCTTAACCACCTCTGTG -3'

Sequencing Primer
(F):5'- CCGTAAAGGAGATGGTCTTCC -3'
(R):5'- TCTGTGGTCCCATGCACGAC -3'
Posted On 2019-06-07