Incidental Mutation 'PIT4453001:Cftr'
ID 555305
Institutional Source Beutler Lab
Gene Symbol Cftr
Ensembl Gene ENSMUSG00000041301
Gene Name cystic fibrosis transmembrane conductance regulator
Synonyms Abcc7
Accession Numbers
Essential gene? Probably non essential (E-score: 0.226) question?
Stock # PIT4453001 (G1)
Quality Score 154.008
Status Not validated
Chromosome 6
Chromosomal Location 18170687-18322768 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 18214106 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 94 (T94A)
Ref Sequence ENSEMBL: ENSMUSP00000049228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045706] [ENSMUST00000115405] [ENSMUST00000115406] [ENSMUST00000129452] [ENSMUST00000140407]
AlphaFold P26361
PDB Structure mouse CFTR NBD1 with AMP.PNP [X-RAY DIFFRACTION]
Cystic fibrosis transmembrane conductance regulator (CFTR) nucleotide-binding domain one (NBD1) apo [X-RAY DIFFRACTION]
Cystic fibrosis transmembrane conductance regulator (CFTR) nucleotide-binding domain one (NBD1) with ATP [X-RAY DIFFRACTION]
Cystic fibrosis transmembrane conductance regulator (CFTR) nucleotide-binding domain one (NBD1) with ADP [X-RAY DIFFRACTION]
Phosphorylated Cystic fibrosis transmembrane conductance regulator (CFTR) nucleotide-binding domain one (NBD1) with ATP [X-RAY DIFFRACTION]
Cystic fibrosis transmembrane conductance regulator (CFTR) nucleotide-binding domain one (NBD1) with ATP, I4122 space group [X-RAY DIFFRACTION]
Structure of NBD1 from murine CFTR- F508S mutant [X-RAY DIFFRACTION]
Structure of NBD1 from murine CFTR- F508R mutant [X-RAY DIFFRACTION]
The crystal structure of the NBD1 domain of the mouse CFTR protein, deltaF508 mutant [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000045706
AA Change: T94A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000049228
Gene: ENSMUSG00000041301
AA Change: T94A

DomainStartEndE-ValueType
Pfam:ABC_membrane 81 350 3.7e-40 PFAM
AAA 450 623 2.16e-12 SMART
Pfam:CFTR_R 639 844 2e-93 PFAM
Pfam:ABC_membrane 857 1142 2.7e-53 PFAM
AAA 1232 1414 9.94e-12 SMART
low complexity region 1465 1474 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115405
AA Change: T94A

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111064
Gene: ENSMUSG00000041301
AA Change: T94A

DomainStartEndE-ValueType
Pfam:ABC_membrane 81 350 1.4e-48 PFAM
Pfam:ABC_tran 441 570 2.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115406
AA Change: T94A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111065
Gene: ENSMUSG00000041301
AA Change: T94A

DomainStartEndE-ValueType
Pfam:ABC_membrane 81 167 4e-14 PFAM
Pfam:ABC_membrane 162 320 2.5e-20 PFAM
AAA 420 593 2.16e-12 SMART
Pfam:CFTR_R 609 815 1.3e-97 PFAM
Pfam:ABC_membrane 827 1112 1e-50 PFAM
AAA 1202 1384 9.94e-12 SMART
low complexity region 1435 1444 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000129452
AA Change: T94A

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115334
Gene: ENSMUSG00000041301
AA Change: T94A

DomainStartEndE-ValueType
Pfam:ABC_membrane 81 350 3.9e-39 PFAM
Pfam:ABC_tran 441 528 5.6e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000140407
AA Change: T94A

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000116957
Gene: ENSMUSG00000041301
AA Change: T94A

DomainStartEndE-ValueType
Pfam:ABC_membrane 81 350 1.2e-48 PFAM
Pfam:ABC_tran 441 568 6.3e-20 PFAM
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.9%
  • 10x: 85.6%
  • 20x: 74.1%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This gene encodes the cystic fibrosis transmembrane regulator and a chloride channel that controls the regulation of other transport pathways. Mutations in this gene have been associated with autosomal recessive disorders such as cystic fibrosis and congenital bilateral aplasia of the vas deferens. Alternative splicing of exons 4, 5, and 11 have been observed, but full-length transcripts have not yet been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit high mortality associated with intestinal obstruction, and altered mucous and serous glands. Mutants, like humans with cystic fibrosis, also exhibit defective epithelial chloride transport. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T G 3: 122,105,316 I649S probably damaging Het
Abcc2 T A 19: 43,803,782 L334* probably null Het
Adam28 A T 14: 68,634,876 S306T probably benign Het
Adam34 T A 8: 43,651,312 D432V probably damaging Het
Adcy7 A G 8: 88,323,636 Y723C probably benign Het
Adgre5 T A 8: 83,724,460 M713L probably benign Het
Aebp2 C A 6: 140,637,686 C295* probably null Het
Amn1 G T 6: 149,170,859 Q127K probably benign Het
Atcay C T 10: 81,210,549 V314M probably damaging Het
Atp1a1 T C 3: 101,581,179 E847G probably benign Het
Atp2b1 A G 10: 99,016,978 E1039G probably benign Het
Caskin1 A G 17: 24,499,292 Y292C probably damaging Het
Ciart T A 3: 95,880,476 K182M probably damaging Het
Col1a2 A C 6: 4,527,079 S603R possibly damaging Het
Cspp1 C A 1: 10,074,872 S298R possibly damaging Het
Cul7 T A 17: 46,651,820 C126S probably damaging Het
Cyp2c55 A T 19: 39,011,791 I145F probably damaging Het
Cypt4 G C 9: 24,625,474 A87P probably damaging Het
Disp2 G A 2: 118,787,644 V224M probably benign Het
Dlgap5 TTC T 14: 47,401,522 probably null Het
Dock1 A G 7: 135,152,300 K1602R probably benign Het
Ears2 T C 7: 122,048,339 I241V probably benign Het
Eml6 T C 11: 29,802,489 T975A probably damaging Het
Ephb2 T C 4: 136,660,810 T660A probably benign Het
Fbxw7 G A 3: 84,965,314 V268M Het
Gart A G 16: 91,636,538 F289S probably damaging Het
Gmcl1 G T 6: 86,704,538 N391K probably benign Het
Greb1l A C 18: 10,533,031 Q975P probably damaging Het
Greb1l G T 18: 10,533,032 Q975H probably benign Het
Grik5 C A 7: 25,010,694 R872L probably damaging Het
Hmox2 T A 16: 4,765,057 I218N probably damaging Het
Hook1 A T 4: 96,014,852 D526V probably damaging Het
Ifna4 A T 4: 88,841,954 N32Y probably damaging Het
Ighg2b T A 12: 113,306,872 N213Y unknown Het
Itih4 G A 14: 30,901,170 V900I probably benign Het
Itpr2 A T 6: 146,373,173 F837Y probably damaging Het
Kif3a T C 11: 53,579,114 V147A probably benign Het
Klra9 T A 6: 130,191,321 probably benign Het
Lamp3 G T 16: 19,673,460 Q345K probably benign Het
Ltbp3 G A 19: 5,757,794 E1188K probably damaging Het
Med1 T A 11: 98,158,417 I518L probably benign Het
Mis18bp1 T C 12: 65,158,673 T242A probably damaging Het
Nemp1 T A 10: 127,696,254 F392Y probably benign Het
Obscn C A 11: 59,060,976 G3984W probably damaging Het
Obscn T A 11: 59,069,834 H3217L possibly damaging Het
Olfr1157 C T 2: 87,962,458 V145M possibly damaging Het
Olfr1328 A G 4: 118,934,626 M74T probably benign Het
Olfr1532-ps1 C T 7: 106,914,929 H244Y probably damaging Het
Olfr709-ps1 T C 7: 106,926,842 I206V probably benign Het
Olfr71 A G 4: 43,706,464 Y35H probably damaging Het
P4ha1 G T 10: 59,350,472 A258S probably benign Het
Parn T C 16: 13,607,281 I423V probably benign Het
Pcdh20 C A 14: 88,467,308 S852I probably damaging Het
Pcnx3 A G 19: 5,672,756 probably null Het
Pcsk1 A T 13: 75,112,650 I331F probably damaging Het
Pkd1l2 G T 8: 117,022,022 S1803R probably benign Het
Pkd1l3 C A 8: 109,660,801 N1792K probably damaging Het
Plekhg1 C A 10: 3,963,469 Q1119K Het
Prr30 T A 14: 101,198,935 T64S probably benign Het
Rec114 T C 9: 58,660,370 N111S probably benign Het
Reck G A 4: 43,895,850 V79I probably benign Het
Rexo1 A G 10: 80,550,397 F276L probably damaging Het
Rgs6 T C 12: 83,091,779 Y296H probably damaging Het
Sdk1 A G 5: 142,212,038 R2149G probably benign Het
Slc20a2 C A 8: 22,535,382 F33L probably damaging Het
Spopl T A 2: 23,545,449 T25S probably damaging Het
Srcap A T 7: 127,549,320 I1947F possibly damaging Het
Srek1 A C 13: 103,744,783 probably null Het
St8sia1 C T 6: 142,829,252 W200* probably null Het
Tas2r106 A T 6: 131,678,502 F129I possibly damaging Het
Tbrg4 A T 11: 6,620,857 L205Q probably damaging Het
Tchh C A 3: 93,445,880 R876S unknown Het
Thap12 G T 7: 98,715,038 A138S probably benign Het
Tjp1 C T 7: 65,343,614 probably null Het
Traf4 G A 11: 78,161,534 P95L probably benign Het
Trappc9 ATCTC ATCTCTC 15: 73,031,598 probably null Het
Usp20 G A 2: 31,017,486 V677M possibly damaging Het
Usp50 C A 2: 126,783,316 probably benign Het
Vmn1r21 T C 6: 57,844,322 T46A probably benign Het
Vmn2r54 T A 7: 12,629,742 H408L probably benign Het
Zfp266 T C 9: 20,506,003 T30A probably benign Het
Zfp536 T C 7: 37,479,757 H1141R probably benign Het
Other mutations in Cftr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Cftr APN 6 18268430 critical splice donor site probably null
IGL01082:Cftr APN 6 18226103 missense probably damaging 0.97
IGL01113:Cftr APN 6 18270253 missense probably damaging 1.00
IGL01383:Cftr APN 6 18226041 missense probably benign 0.00
IGL01595:Cftr APN 6 18198239 splice site probably benign
IGL01820:Cftr APN 6 18226139 missense probably damaging 1.00
IGL02223:Cftr APN 6 18221482 missense probably damaging 1.00
IGL02249:Cftr APN 6 18277871 missense possibly damaging 0.58
IGL02439:Cftr APN 6 18258238 nonsense probably null
IGL02537:Cftr APN 6 18274597 missense probably benign 0.31
IGL03234:Cftr APN 6 18225988 missense probably damaging 0.96
BB004:Cftr UTSW 6 18267971 missense possibly damaging 0.81
BB014:Cftr UTSW 6 18267971 missense possibly damaging 0.81
PIT4520001:Cftr UTSW 6 18277843 missense probably benign 0.01
R0114:Cftr UTSW 6 18282448 missense probably damaging 1.00
R0329:Cftr UTSW 6 18226097 missense probably null 1.00
R0330:Cftr UTSW 6 18226097 missense probably null 1.00
R0331:Cftr UTSW 6 18235226 missense possibly damaging 0.72
R0480:Cftr UTSW 6 18274518 splice site probably benign
R0612:Cftr UTSW 6 18198126 missense probably benign 0.01
R0633:Cftr UTSW 6 18305980 missense probably damaging 0.99
R0830:Cftr UTSW 6 18270225 missense probably benign 0.02
R1559:Cftr UTSW 6 18225937 missense probably benign 0.01
R1629:Cftr UTSW 6 18226106 missense probably damaging 1.00
R1636:Cftr UTSW 6 18226157 missense probably damaging 0.99
R1860:Cftr UTSW 6 18268289 missense probably benign 0.00
R2043:Cftr UTSW 6 18320935 missense probably benign
R2211:Cftr UTSW 6 18214280 missense probably null 0.13
R4737:Cftr UTSW 6 18299883 missense probably benign 0.19
R4793:Cftr UTSW 6 18226088 missense probably damaging 1.00
R4857:Cftr UTSW 6 18320975 missense possibly damaging 0.92
R4984:Cftr UTSW 6 18235199 missense possibly damaging 0.89
R4999:Cftr UTSW 6 18221614 missense probably benign 0.17
R5045:Cftr UTSW 6 18230081 missense probably benign 0.20
R5183:Cftr UTSW 6 18299833 missense probably damaging 0.99
R5197:Cftr UTSW 6 18255414 missense probably benign 0.00
R5288:Cftr UTSW 6 18226129 nonsense probably null
R5337:Cftr UTSW 6 18319059 missense probably damaging 1.00
R5549:Cftr UTSW 6 18227954 missense probably benign 0.00
R5596:Cftr UTSW 6 18268096 missense probably benign 0.00
R5651:Cftr UTSW 6 18255365 splice site probably null
R5660:Cftr UTSW 6 18313687 missense probably benign 0.22
R5941:Cftr UTSW 6 18313646 missense probably damaging 1.00
R6221:Cftr UTSW 6 18282501 missense probably benign 0.00
R6222:Cftr UTSW 6 18282501 missense probably benign 0.00
R6229:Cftr UTSW 6 18220684 missense probably damaging 1.00
R6256:Cftr UTSW 6 18274661 missense probably damaging 0.96
R6257:Cftr UTSW 6 18282501 missense probably benign 0.00
R6412:Cftr UTSW 6 18285604 missense probably damaging 0.97
R6459:Cftr UTSW 6 18258236 missense probably damaging 1.00
R6558:Cftr UTSW 6 18222528 missense probably damaging 1.00
R6724:Cftr UTSW 6 18255974 nonsense probably null
R6787:Cftr UTSW 6 18274608 nonsense probably null
R6861:Cftr UTSW 6 18268108 missense probably benign 0.00
R6888:Cftr UTSW 6 18313730 critical splice donor site probably null
R7084:Cftr UTSW 6 18226138 missense probably benign 0.17
R7105:Cftr UTSW 6 18318972 missense probably damaging 1.00
R7320:Cftr UTSW 6 18319013 missense probably damaging 0.97
R7359:Cftr UTSW 6 18221624 missense probably benign 0.00
R7466:Cftr UTSW 6 18227973 missense probably benign
R7502:Cftr UTSW 6 18214296 missense probably damaging 1.00
R7748:Cftr UTSW 6 18277889 critical splice donor site probably null
R7808:Cftr UTSW 6 18204205 missense probably benign
R7817:Cftr UTSW 6 18267968 missense probably damaging 0.97
R7927:Cftr UTSW 6 18267971 missense possibly damaging 0.81
R7968:Cftr UTSW 6 18226049 missense probably benign 0.00
R7995:Cftr UTSW 6 18214156 missense probably damaging 1.00
R8171:Cftr UTSW 6 18258288 missense probably damaging 1.00
R8210:Cftr UTSW 6 18220697 missense probably damaging 1.00
R8548:Cftr UTSW 6 18273699 missense possibly damaging 0.87
R8712:Cftr UTSW 6 18274697 missense probably damaging 0.99
R8737:Cftr UTSW 6 18319729 missense probably damaging 1.00
R8926:Cftr UTSW 6 18268004 missense possibly damaging 0.83
R8979:Cftr UTSW 6 18227948 missense probably benign 0.10
R8996:Cftr UTSW 6 18255946 nonsense probably null
R9087:Cftr UTSW 6 18214181 missense possibly damaging 0.91
R9115:Cftr UTSW 6 18235311 missense probably damaging 1.00
R9406:Cftr UTSW 6 18299867 missense probably benign 0.00
R9689:Cftr UTSW 6 18313650 missense probably damaging 0.99
R9700:Cftr UTSW 6 18268360 missense probably damaging 1.00
R9747:Cftr UTSW 6 18285637 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- CATGCAGGTTTTAGTGAACACC -3'
(R):5'- CATTCCAATGCGATGAAGGC -3'

Sequencing Primer
(F):5'- CCTCACACAAACTTGTCTCTAAATG -3'
(R):5'- TCCAATGCGATGAAGGCCAAAAATAG -3'
Posted On 2019-06-07