Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4453001:Itpr2'

555312

Institutional Source

Beutler Lab

Gene Symbol

Itpr2

Ensembl Gene

ENSMUSG00000030287

Gene Name

inositol 1,4,5-triphosphate receptor 2

Synonyms

Itpr5, Ip3r2

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

PIT4453001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

146108299-146502223 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 146373173 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Tyrosine at position 837 (F837Y)

Ref Sequence

ENSEMBL: ENSMUSP00000049584 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053273] [ENSMUST00000079573] [ENSMUST00000131890] [ENSMUST00000139732]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000053273
AA Change: F837Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000049584
Gene: ENSMUSG00000030287
AA Change: F837Y

Domain	Start	End	E-Value	Type
low complexity region	68	80	N/A	INTRINSIC
MIR	112	166	1.1e-5	SMART
MIR	173	223	8.9e-6	SMART
MIR	231	287	5.11e-6	SMART
MIR	294	402	3.73e-8	SMART
Pfam:RYDR_ITPR	473	670	1.5e-62	PFAM
low complexity region	882	890	N/A	INTRINSIC
Pfam:RYDR_ITPR	1183	1346	1.6e-16	PFAM
low complexity region	1773	1785	N/A	INTRINSIC
low complexity region	1897	1908	N/A	INTRINSIC
Pfam:RIH_assoc	1912	2022	4.6e-34	PFAM
low complexity region	2088	2098	N/A	INTRINSIC
transmembrane domain	2228	2250	N/A	INTRINSIC
Pfam:Ion_trans	2260	2552	5.1e-20	PFAM
coiled coil region	2631	2686	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000079573
AA Change: F804Y

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000078526
Gene: ENSMUSG00000030287
AA Change: F804Y

Domain	Start	End	E-Value	Type
low complexity region	68	80	N/A	INTRINSIC
MIR	112	166	1.1e-5	SMART
MIR	198	254	5.11e-6	SMART
MIR	261	369	3.73e-8	SMART
Pfam:RYDR_ITPR	438	644	5.4e-75	PFAM
low complexity region	849	857	N/A	INTRINSIC
Pfam:RYDR_ITPR	1148	1322	7.2e-60	PFAM
low complexity region	1740	1752	N/A	INTRINSIC
Pfam:RIH_assoc	1875	1994	5.8e-35	PFAM
low complexity region	2055	2065	N/A	INTRINSIC
transmembrane domain	2195	2217	N/A	INTRINSIC
transmembrane domain	2230	2249	N/A	INTRINSIC
low complexity region	2268	2279	N/A	INTRINSIC
Pfam:Ion_trans	2281	2507	2.4e-12	PFAM
coiled coil region	2598	2653	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000131890
AA Change: F479Y

PolyPhen 2 Score 0.832 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000121773
Gene: ENSMUSG00000030287
AA Change: F479Y

Domain	Start	End	E-Value	Type
Pfam:MIR	1	74	4.8e-22	PFAM
Pfam:RYDR_ITPR	113	319	1.9e-76	PFAM
low complexity region	524	532	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000139732

SMART Domains

Protein: ENSMUSP00000119110
Gene: ENSMUSG00000030287

Domain	Start	End	E-Value	Type
low complexity region	21	33	N/A	INTRINSIC
MIR	65	119	1.1e-5	SMART
MIR	126	176	8.9e-6	SMART
MIR	184	240	5.11e-6	SMART
MIR	247	355	3.73e-8	SMART
Pfam:RYDR_ITPR	424	630	3e-76	PFAM

Coding Region Coverage

1x: 93.3%
3x: 90.9%
10x: 85.6%
20x: 74.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the inositol 1,4,5-triphosphate receptor family, whose members are second messenger intracellular calcium release channels. These proteins mediate a rise in cytoplasmic calcium in response to receptor activated production of inositol triphosphate. Inositol triphosphate receptor-mediated signaling is involved in many processes including cell migration, cell division, smooth muscle contraction, and neuronal signaling. This protein is a type 2 receptor that consists of a cytoplasmic amino-terminus that binds inositol triphosphate, six membrane-spanning helices that contribute to the ion pore, and a short cytoplasmic carboxy-terminus. A mutation in this gene has been associated with anhidrosis, suggesting that intracellular calcium release mediated by this protein is required for eccrine sweat production. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for a knock-out allele are viable and fertile but show decreased sweating and disturbed calcium signaling in sweat glands. Mice homozygous for a different knock-out allele have atrial myocytes that are significantly less prone to develop proarrhythmic disturbances in calcium signaling. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	T	G	3: 122,105,316	I649S	probably damaging	Het
Abcc2	T	A	19: 43,803,782	L334*	probably null	Het
Adam28	A	T	14: 68,634,876	S306T	probably benign	Het
Adam34	T	A	8: 43,651,312	D432V	probably damaging	Het
Adcy7	A	G	8: 88,323,636	Y723C	probably benign	Het
Adgre5	T	A	8: 83,724,460	M713L	probably benign	Het
Aebp2	C	A	6: 140,637,686	C295*	probably null	Het
Amn1	G	T	6: 149,170,859	Q127K	probably benign	Het
Atcay	C	T	10: 81,210,549	V314M	probably damaging	Het
Atp1a1	T	C	3: 101,581,179	E847G	probably benign	Het
Atp2b1	A	G	10: 99,016,978	E1039G	probably benign	Het
Caskin1	A	G	17: 24,499,292	Y292C	probably damaging	Het
Cftr	A	G	6: 18,214,106	T94A	probably damaging	Het
Ciart	T	A	3: 95,880,476	K182M	probably damaging	Het
Col1a2	A	C	6: 4,527,079	S603R	possibly damaging	Het
Cspp1	C	A	1: 10,074,872	S298R	possibly damaging	Het
Cul7	T	A	17: 46,651,820	C126S	probably damaging	Het
Cyp2c55	A	T	19: 39,011,791	I145F	probably damaging	Het
Cypt4	G	C	9: 24,625,474	A87P	probably damaging	Het
Disp2	G	A	2: 118,787,644	V224M	probably benign	Het
Dlgap5	TTC	T	14: 47,401,522		probably null	Het
Dock1	A	G	7: 135,152,300	K1602R	probably benign	Het
Ears2	T	C	7: 122,048,339	I241V	probably benign	Het
Eml6	T	C	11: 29,802,489	T975A	probably damaging	Het
Ephb2	T	C	4: 136,660,810	T660A	probably benign	Het
Fbxw7	G	A	3: 84,965,314	V268M		Het
Gart	A	G	16: 91,636,538	F289S	probably damaging	Het
Gmcl1	G	T	6: 86,704,538	N391K	probably benign	Het
Greb1l	A	C	18: 10,533,031	Q975P	probably damaging	Het
Greb1l	G	T	18: 10,533,032	Q975H	probably benign	Het
Grik5	C	A	7: 25,010,694	R872L	probably damaging	Het
Hmox2	T	A	16: 4,765,057	I218N	probably damaging	Het
Hook1	A	T	4: 96,014,852	D526V	probably damaging	Het
Ifna4	A	T	4: 88,841,954	N32Y	probably damaging	Het
Ighg2b	T	A	12: 113,306,872	N213Y	unknown	Het
Itih4	G	A	14: 30,901,170	V900I	probably benign	Het
Kif3a	T	C	11: 53,579,114	V147A	probably benign	Het
Klra9	T	A	6: 130,191,321		probably benign	Het
Lamp3	G	T	16: 19,673,460	Q345K	probably benign	Het
Ltbp3	G	A	19: 5,757,794	E1188K	probably damaging	Het
Med1	T	A	11: 98,158,417	I518L	probably benign	Het
Mis18bp1	T	C	12: 65,158,673	T242A	probably damaging	Het
Nemp1	T	A	10: 127,696,254	F392Y	probably benign	Het
Obscn	C	A	11: 59,060,976	G3984W	probably damaging	Het
Obscn	T	A	11: 59,069,834	H3217L	possibly damaging	Het
Olfr1157	C	T	2: 87,962,458	V145M	possibly damaging	Het
Olfr1328	A	G	4: 118,934,626	M74T	probably benign	Het
Olfr1532-ps1	C	T	7: 106,914,929	H244Y	probably damaging	Het
Olfr709-ps1	T	C	7: 106,926,842	I206V	probably benign	Het
Olfr71	A	G	4: 43,706,464	Y35H	probably damaging	Het
P4ha1	G	T	10: 59,350,472	A258S	probably benign	Het
Parn	T	C	16: 13,607,281	I423V	probably benign	Het
Pcdh20	C	A	14: 88,467,308	S852I	probably damaging	Het
Pcnx3	A	G	19: 5,672,756		probably null	Het
Pcsk1	A	T	13: 75,112,650	I331F	probably damaging	Het
Pkd1l2	G	T	8: 117,022,022	S1803R	probably benign	Het
Pkd1l3	C	A	8: 109,660,801	N1792K	probably damaging	Het
Plekhg1	C	A	10: 3,963,469	Q1119K		Het
Prr30	T	A	14: 101,198,935	T64S	probably benign	Het
Rec114	T	C	9: 58,660,370	N111S	probably benign	Het
Reck	G	A	4: 43,895,850	V79I	probably benign	Het
Rexo1	A	G	10: 80,550,397	F276L	probably damaging	Het
Rgs6	T	C	12: 83,091,779	Y296H	probably damaging	Het
Sdk1	A	G	5: 142,212,038	R2149G	probably benign	Het
Slc20a2	C	A	8: 22,535,382	F33L	probably damaging	Het
Spopl	T	A	2: 23,545,449	T25S	probably damaging	Het
Srcap	A	T	7: 127,549,320	I1947F	possibly damaging	Het
Srek1	A	C	13: 103,744,783		probably null	Het
St8sia1	C	T	6: 142,829,252	W200*	probably null	Het
Tas2r106	A	T	6: 131,678,502	F129I	possibly damaging	Het
Tbrg4	A	T	11: 6,620,857	L205Q	probably damaging	Het
Tchh	C	A	3: 93,445,880	R876S	unknown	Het
Thap12	G	T	7: 98,715,038	A138S	probably benign	Het
Tjp1	C	T	7: 65,343,614		probably null	Het
Traf4	G	A	11: 78,161,534	P95L	probably benign	Het
Trappc9	ATCTC	ATCTCTC	15: 73,031,598		probably null	Het
Usp20	G	A	2: 31,017,486	V677M	possibly damaging	Het
Usp50	C	A	2: 126,783,316		probably benign	Het
Vmn1r21	T	C	6: 57,844,322	T46A	probably benign	Het
Vmn2r54	T	A	7: 12,629,742	H408L	probably benign	Het
Zfp266	T	C	9: 20,506,003	T30A	probably benign	Het
Zfp536	T	C	7: 37,479,757	H1141R	probably benign	Het

Other mutations in Itpr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Itpr2	APN	6	146397012	missense	probably damaging	0.99
IGL00163:Itpr2	APN	6	146390836	missense	possibly damaging	0.88
IGL00229:Itpr2	APN	6	146144185	missense	probably damaging	1.00
IGL00712:Itpr2	APN	6	146232436	missense	possibly damaging	0.63
IGL00952:Itpr2	APN	6	146158961	missense	probably damaging	1.00
IGL00983:Itpr2	APN	6	146310981	splice site	probably benign
IGL01012:Itpr2	APN	6	146345161	missense	probably damaging	1.00
IGL01289:Itpr2	APN	6	146112535	nonsense	probably null
IGL01411:Itpr2	APN	6	146376062	critical splice donor site	probably null
IGL01557:Itpr2	APN	6	146158976	missense	probably damaging	0.99
IGL01669:Itpr2	APN	6	146180229	missense	probably damaging	1.00
IGL01809:Itpr2	APN	6	146227581	missense	probably damaging	1.00
IGL01814:Itpr2	APN	6	146232546	missense	probably benign	0.02
IGL02198:Itpr2	APN	6	146323227	missense	probably damaging	1.00
IGL02218:Itpr2	APN	6	146240262	splice site	probably benign
IGL02332:Itpr2	APN	6	146426542	missense	probably damaging	1.00
IGL02425:Itpr2	APN	6	146391321	missense	probably damaging	0.99
IGL02432:Itpr2	APN	6	146325173	missense	probably benign	0.05
IGL02726:Itpr2	APN	6	146375921	missense	probably benign	0.18
IGL02851:Itpr2	APN	6	146385979	missense	probably damaging	0.99
IGL02933:Itpr2	APN	6	146312904	missense	probably benign
IGL03015:Itpr2	APN	6	146375937	missense	probably benign
IGL03067:Itpr2	APN	6	146325182	missense	probably damaging	1.00
IGL03093:Itpr2	APN	6	146379510	missense	probably damaging	1.00
IGL03214:Itpr2	APN	6	146180244	missense	probably benign	0.02
IGL03275:Itpr2	APN	6	146158877	splice site	probably benign
IGL03332:Itpr2	APN	6	146144149	missense	probably damaging	0.98
IGL03352:Itpr2	APN	6	146157104	missense	probably damaging	1.00
IGL03377:Itpr2	APN	6	146329715	missense	probably damaging	0.96
IGL03377:Itpr2	APN	6	146329758	missense	probably benign
dollar_short	UTSW	6	146397019	nonsense	probably null
enfermos	UTSW	6	146234006	missense	probably damaging	0.98
Hopla	UTSW	6	146194598	missense	probably damaging	0.98
P0029:Itpr2	UTSW	6	146379489	missense	probably damaging	1.00
PIT4431001:Itpr2	UTSW	6	146354720	missense	probably benign
PIT4504001:Itpr2	UTSW	6	146229871	missense	probably damaging	0.99
R0040:Itpr2	UTSW	6	146345140	missense	probably damaging	1.00
R0040:Itpr2	UTSW	6	146345140	missense	probably damaging	1.00
R0048:Itpr2	UTSW	6	146232291	splice site	probably null
R0048:Itpr2	UTSW	6	146232291	splice site	probably null
R0055:Itpr2	UTSW	6	146323133	missense	probably benign	0.42
R0055:Itpr2	UTSW	6	146323133	missense	probably benign	0.42
R0088:Itpr2	UTSW	6	146241185	missense	probably benign
R0089:Itpr2	UTSW	6	146350022	critical splice donor site	probably null
R0114:Itpr2	UTSW	6	146312879	missense	probably damaging	1.00
R0125:Itpr2	UTSW	6	146240453	missense	probably benign	0.00
R0144:Itpr2	UTSW	6	146327155	missense	probably damaging	0.98
R0180:Itpr2	UTSW	6	146501909	start gained	probably benign
R0211:Itpr2	UTSW	6	146194613	missense	probably benign	0.17
R0305:Itpr2	UTSW	6	146311103	missense	possibly damaging	0.63
R0367:Itpr2	UTSW	6	146234008	missense	probably damaging	1.00
R0374:Itpr2	UTSW	6	146359392	missense	probably benign	0.00
R0391:Itpr2	UTSW	6	146229773	missense	probably damaging	1.00
R0450:Itpr2	UTSW	6	146417979	missense	possibly damaging	0.66
R0464:Itpr2	UTSW	6	146375889	missense	probably damaging	1.00
R0510:Itpr2	UTSW	6	146417979	missense	possibly damaging	0.66
R0532:Itpr2	UTSW	6	146112400	missense	probably damaging	1.00
R0625:Itpr2	UTSW	6	146166651	missense	probably benign
R0633:Itpr2	UTSW	6	146374456	missense	probably damaging	1.00
R0636:Itpr2	UTSW	6	146171412	missense	probably damaging	1.00
R1086:Itpr2	UTSW	6	146350045	missense	probably damaging	1.00
R1352:Itpr2	UTSW	6	146111742	missense	probably damaging	1.00
R1631:Itpr2	UTSW	6	146180290	missense	probably damaging	1.00
R1655:Itpr2	UTSW	6	146376148	missense	probably damaging	1.00
R1767:Itpr2	UTSW	6	146350068	missense	possibly damaging	0.91
R1779:Itpr2	UTSW	6	146158901	nonsense	probably null
R1796:Itpr2	UTSW	6	146296673	missense	probably benign
R1815:Itpr2	UTSW	6	146359416	missense	probably benign	0.08
R1827:Itpr2	UTSW	6	146328332	missense	probably damaging	1.00
R1828:Itpr2	UTSW	6	146328332	missense	probably damaging	1.00
R1884:Itpr2	UTSW	6	146385971	missense	probably benign	0.16
R1902:Itpr2	UTSW	6	146229703	missense	probably damaging	1.00
R1931:Itpr2	UTSW	6	146240354	missense	probably benign	0.41
R1964:Itpr2	UTSW	6	146111693	missense	probably damaging	1.00
R2010:Itpr2	UTSW	6	146227524	splice site	probably null
R2168:Itpr2	UTSW	6	146111678	missense	probably benign	0.05
R2179:Itpr2	UTSW	6	146375966	missense	probably benign
R2290:Itpr2	UTSW	6	146422828	missense	probably damaging	1.00
R2874:Itpr2	UTSW	6	146426498	missense	possibly damaging	0.73
R2888:Itpr2	UTSW	6	146171293	missense	probably damaging	1.00
R2897:Itpr2	UTSW	6	146173341	missense	probably benign	0.03
R2897:Itpr2	UTSW	6	146323169	missense	probably damaging	1.00
R2898:Itpr2	UTSW	6	146173341	missense	probably benign	0.03
R2898:Itpr2	UTSW	6	146323169	missense	probably damaging	1.00
R3024:Itpr2	UTSW	6	146180310	missense	probably benign	0.35
R3104:Itpr2	UTSW	6	146312837	critical splice donor site	probably null
R3607:Itpr2	UTSW	6	146227601	missense	probably damaging	0.98
R3732:Itpr2	UTSW	6	146382700	missense	probably damaging	1.00
R3732:Itpr2	UTSW	6	146382700	missense	probably damaging	1.00
R3733:Itpr2	UTSW	6	146382700	missense	probably damaging	1.00
R3792:Itpr2	UTSW	6	146415354	missense	probably damaging	1.00
R3806:Itpr2	UTSW	6	146232291	splice site	probably null
R3821:Itpr2	UTSW	6	146417726	missense	probably damaging	1.00
R3929:Itpr2	UTSW	6	146374359	splice site	probably null
R3958:Itpr2	UTSW	6	146425510	missense	probably damaging	0.97
R3959:Itpr2	UTSW	6	146425510	missense	probably damaging	0.97
R3960:Itpr2	UTSW	6	146229764	missense	probably damaging	1.00
R3960:Itpr2	UTSW	6	146425510	missense	probably damaging	0.97
R4074:Itpr2	UTSW	6	146373244	splice site	probably null
R4085:Itpr2	UTSW	6	146144248	missense	probably damaging	1.00
R4114:Itpr2	UTSW	6	146425510	missense	probably damaging	0.97
R4115:Itpr2	UTSW	6	146425510	missense	probably damaging	0.97
R4588:Itpr2	UTSW	6	146241196	missense	probably benign	0.33
R4663:Itpr2	UTSW	6	146373173	missense	probably damaging	1.00
R4673:Itpr2	UTSW	6	146373173	missense	probably damaging	1.00
R4684:Itpr2	UTSW	6	146373173	missense	probably damaging	1.00
R4686:Itpr2	UTSW	6	146229775	missense	probably damaging	1.00
R4713:Itpr2	UTSW	6	146373173	missense	probably damaging	1.00
R4713:Itpr2	UTSW	6	146396958	missense	probably damaging	1.00
R4729:Itpr2	UTSW	6	146373173	missense	probably damaging	1.00
R4732:Itpr2	UTSW	6	146373173	missense	probably damaging	1.00
R4733:Itpr2	UTSW	6	146373173	missense	probably damaging	1.00
R4801:Itpr2	UTSW	6	146371331	missense	probably damaging	1.00
R4802:Itpr2	UTSW	6	146371331	missense	probably damaging	1.00
R4877:Itpr2	UTSW	6	146325205	missense	probably damaging	1.00
R4970:Itpr2	UTSW	6	146233991	missense	possibly damaging	0.95
R4986:Itpr2	UTSW	6	146240342	missense	probably damaging	0.96
R5112:Itpr2	UTSW	6	146233991	missense	possibly damaging	0.95
R5200:Itpr2	UTSW	6	146144107	critical splice donor site	probably null
R5224:Itpr2	UTSW	6	146166651	missense	probably benign
R5243:Itpr2	UTSW	6	146187546	missense	probably damaging	1.00
R5348:Itpr2	UTSW	6	146476693	missense	possibly damaging	0.78
R5393:Itpr2	UTSW	6	146376155	nonsense	probably null
R5552:Itpr2	UTSW	6	146294080	missense	probably benign
R5579:Itpr2	UTSW	6	146173366	nonsense	probably null
R5744:Itpr2	UTSW	6	146376151	missense	probably damaging	1.00
R5825:Itpr2	UTSW	6	146144149	missense	probably damaging	0.98
R5910:Itpr2	UTSW	6	146329571	missense	probably benign	0.10
R5911:Itpr2	UTSW	6	146312943	missense	probably benign	0.42
R6044:Itpr2	UTSW	6	146396951	missense	probably null	0.98
R6072:Itpr2	UTSW	6	146347111	missense	probably damaging	0.98
R6191:Itpr2	UTSW	6	146328335	missense	probably benign	0.01
R6483:Itpr2	UTSW	6	146112477	missense	possibly damaging	0.52
R6511:Itpr2	UTSW	6	146329727	missense	probably damaging	1.00
R6524:Itpr2	UTSW	6	146345211	missense	probably benign	0.01
R6561:Itpr2	UTSW	6	146234006	missense	probably damaging	0.98
R6594:Itpr2	UTSW	6	146190480	missense	possibly damaging	0.71
R6603:Itpr2	UTSW	6	146347171	missense	probably damaging	0.98
R6736:Itpr2	UTSW	6	146325170	missense	probably damaging	1.00
R6783:Itpr2	UTSW	6	146385873	critical splice donor site	probably null
R6831:Itpr2	UTSW	6	146112429	missense	probably damaging	1.00
R6857:Itpr2	UTSW	6	146397019	nonsense	probably null
R7103:Itpr2	UTSW	6	146325074	missense	probably damaging	1.00
R7111:Itpr2	UTSW	6	146325056	missense	probably damaging	1.00
R7126:Itpr2	UTSW	6	146357796	nonsense	probably null
R7165:Itpr2	UTSW	6	146294091	missense	probably damaging	1.00
R7184:Itpr2	UTSW	6	146311087	missense	possibly damaging	0.79
R7249:Itpr2	UTSW	6	146311052	missense	probably damaging	1.00
R7292:Itpr2	UTSW	6	146158949	missense	possibly damaging	0.95
R7342:Itpr2	UTSW	6	146327187	missense	probably damaging	0.98
R7392:Itpr2	UTSW	6	146359340	missense	possibly damaging	0.95
R7414:Itpr2	UTSW	6	146373208	missense	probably benign	0.06
R7448:Itpr2	UTSW	6	146329508	missense	probably damaging	1.00
R7492:Itpr2	UTSW	6	146390938	missense	probably damaging	1.00
R7515:Itpr2	UTSW	6	146327110	missense	probably damaging	1.00
R7529:Itpr2	UTSW	6	146194598	missense	probably damaging	0.98
R7558:Itpr2	UTSW	6	146390865	missense	probably damaging	1.00
R7650:Itpr2	UTSW	6	146233994	missense	probably benign	0.36
R7678:Itpr2	UTSW	6	146187550	missense	probably benign	0.00
R7790:Itpr2	UTSW	6	146224776	missense	probably damaging	1.00
R7798:Itpr2	UTSW	6	146386015	missense	probably benign	0.06
R7831:Itpr2	UTSW	6	146291584	missense	probably benign	0.04
R8023:Itpr2	UTSW	6	146187490	missense	probably damaging	0.97
R8046:Itpr2	UTSW	6	146426459	missense	probably damaging	0.96
R8236:Itpr2	UTSW	6	146390783	critical splice donor site	probably null
R8241:Itpr2	UTSW	6	146418515	missense	possibly damaging	0.90
R8245:Itpr2	UTSW	6	146373106	missense	probably damaging	0.98
R8324:Itpr2	UTSW	6	146328398	missense	probably damaging	0.97
R8339:Itpr2	UTSW	6	146312898	missense	probably benign	0.19
R8458:Itpr2	UTSW	6	146233966	missense	possibly damaging	0.62
R8506:Itpr2	UTSW	6	146418416	critical splice donor site	probably null
R8529:Itpr2	UTSW	6	146329553	missense	probably damaging	1.00
R8672:Itpr2	UTSW	6	146374518	missense	probably damaging	1.00
R8755:Itpr2	UTSW	6	146232428	missense	probably benign
R8816:Itpr2	UTSW	6	146241212	missense	probably damaging	0.98
R9160:Itpr2	UTSW	6	146374601	missense	probably damaging	1.00
R9273:Itpr2	UTSW	6	146325031	missense	probably damaging	1.00
R9284:Itpr2	UTSW	6	146354676	missense	probably benign	0.01
R9322:Itpr2	UTSW	6	146325089	missense	probably benign	0.19
R9357:Itpr2	UTSW	6	146359316	missense	probably damaging	1.00
R9424:Itpr2	UTSW	6	146311007	missense	probably damaging	0.98
R9438:Itpr2	UTSW	6	146166668	missense	probably benign
R9576:Itpr2	UTSW	6	146311007	missense	probably damaging	0.98
V8831:Itpr2	UTSW	6	146385882	missense	probably damaging	1.00
X0054:Itpr2	UTSW	6	146323236	missense	probably damaging	1.00
X0063:Itpr2	UTSW	6	146180353	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCACCTGGTTTCTAGCAAGAATAC -3'
(R):5'- TTGACGTGTCCAAGGCAGTG -3'

Sequencing Primer
(F):5'- TGGTTCTCAGCACCCACATGG -3'
(R):5'- TGCACTCTAGGAGTCAGACTG -3'

Posted On

2019-06-07