Incidental Mutation 'PIT4453001:Zfp536'
ID 555316
Institutional Source Beutler Lab
Gene Symbol Zfp536
Ensembl Gene ENSMUSG00000043456
Gene Name zinc finger protein 536
Synonyms 9630010P11Rik
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # PIT4453001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 37017449-37473066 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 37179182 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 1141 (H1141R)
Ref Sequence ENSEMBL: ENSMUSP00000058468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056338] [ENSMUST00000175941] [ENSMUST00000176114] [ENSMUST00000176129] [ENSMUST00000176205]
AlphaFold Q8K083
Predicted Effect probably benign
Transcript: ENSMUST00000056338
AA Change: H1141R

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000058468
Gene: ENSMUSG00000043456
AA Change: H1141R

DomainStartEndE-ValueType
ZnF_C2H2 130 152 5.14e-3 SMART
ZnF_C2H2 158 180 8.47e-4 SMART
low complexity region 193 205 N/A INTRINSIC
ZnF_C2H2 274 297 1.03e-2 SMART
ZnF_C2H2 300 323 4.4e-2 SMART
ZnF_C2H2 345 367 3.69e-4 SMART
ZnF_C2H2 373 395 1.26e-2 SMART
ZnF_C2H2 631 653 2.91e-2 SMART
Pfam:zf-C2H2_assoc 657 739 6.6e-43 PFAM
ZnF_C2H2 753 775 6.78e-3 SMART
ZnF_C2H2 781 803 7.26e-3 SMART
low complexity region 928 941 N/A INTRINSIC
ZnF_C2H2 1002 1025 7.29e0 SMART
low complexity region 1198 1212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175941
AA Change: H1141R

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000134778
Gene: ENSMUSG00000043456
AA Change: H1141R

DomainStartEndE-ValueType
ZnF_C2H2 130 152 5.14e-3 SMART
ZnF_C2H2 158 180 8.47e-4 SMART
low complexity region 193 205 N/A INTRINSIC
ZnF_C2H2 274 297 1.03e-2 SMART
ZnF_C2H2 300 323 4.4e-2 SMART
ZnF_C2H2 345 367 3.69e-4 SMART
ZnF_C2H2 373 395 1.26e-2 SMART
ZnF_C2H2 631 653 2.91e-2 SMART
low complexity region 716 725 N/A INTRINSIC
ZnF_C2H2 753 775 6.78e-3 SMART
ZnF_C2H2 781 803 7.26e-3 SMART
low complexity region 928 941 N/A INTRINSIC
ZnF_C2H2 1002 1025 7.29e0 SMART
low complexity region 1198 1212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176114
AA Change: H1141R

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000135681
Gene: ENSMUSG00000043456
AA Change: H1141R

DomainStartEndE-ValueType
ZnF_C2H2 130 152 5.14e-3 SMART
ZnF_C2H2 158 180 8.47e-4 SMART
low complexity region 193 205 N/A INTRINSIC
ZnF_C2H2 274 297 1.03e-2 SMART
ZnF_C2H2 300 323 4.4e-2 SMART
ZnF_C2H2 345 367 3.69e-4 SMART
ZnF_C2H2 373 395 1.26e-2 SMART
ZnF_C2H2 631 653 2.91e-2 SMART
low complexity region 716 725 N/A INTRINSIC
ZnF_C2H2 753 775 6.78e-3 SMART
ZnF_C2H2 781 803 7.26e-3 SMART
low complexity region 928 941 N/A INTRINSIC
ZnF_C2H2 1002 1025 7.29e0 SMART
low complexity region 1198 1212 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000176129
AA Change: H77R

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000135234
Gene: ENSMUSG00000043456
AA Change: H77R

DomainStartEndE-ValueType
low complexity region 134 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176205
AA Change: H1141R

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000135068
Gene: ENSMUSG00000043456
AA Change: H1141R

DomainStartEndE-ValueType
ZnF_C2H2 130 152 5.14e-3 SMART
ZnF_C2H2 158 180 8.47e-4 SMART
low complexity region 193 205 N/A INTRINSIC
ZnF_C2H2 274 297 1.03e-2 SMART
ZnF_C2H2 300 323 4.4e-2 SMART
ZnF_C2H2 345 367 3.69e-4 SMART
ZnF_C2H2 373 395 1.26e-2 SMART
ZnF_C2H2 631 653 2.91e-2 SMART
low complexity region 716 725 N/A INTRINSIC
ZnF_C2H2 753 775 6.78e-3 SMART
ZnF_C2H2 781 803 7.26e-3 SMART
low complexity region 928 941 N/A INTRINSIC
ZnF_C2H2 1002 1025 7.29e0 SMART
low complexity region 1198 1212 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.9%
  • 10x: 85.6%
  • 20x: 74.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a highly conserved zinc finger protein. The encoded protein is most abundant in brain, where it negatively regulates neuronal differentiation. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T G 3: 121,898,965 (GRCm39) I649S probably damaging Het
Abcc2 T A 19: 43,792,221 (GRCm39) L334* probably null Het
Adam28 A T 14: 68,872,325 (GRCm39) S306T probably benign Het
Adam34 T A 8: 44,104,349 (GRCm39) D432V probably damaging Het
Adcy7 A G 8: 89,050,264 (GRCm39) Y723C probably benign Het
Adgre5 T A 8: 84,451,089 (GRCm39) M713L probably benign Het
Aebp2 C A 6: 140,583,412 (GRCm39) C295* probably null Het
Amn1 G T 6: 149,072,357 (GRCm39) Q127K probably benign Het
Atcay C T 10: 81,046,383 (GRCm39) V314M probably damaging Het
Atp1a1 T C 3: 101,488,495 (GRCm39) E847G probably benign Het
Atp2b1 A G 10: 98,852,840 (GRCm39) E1039G probably benign Het
Caskin1 A G 17: 24,718,266 (GRCm39) Y292C probably damaging Het
Cftr A G 6: 18,214,105 (GRCm39) T94A probably damaging Het
Ciart T A 3: 95,787,788 (GRCm39) K182M probably damaging Het
Col1a2 A C 6: 4,527,079 (GRCm39) S603R possibly damaging Het
Cspp1 C A 1: 10,145,097 (GRCm39) S298R possibly damaging Het
Cul7 T A 17: 46,962,746 (GRCm39) C126S probably damaging Het
Cyp2c55 A T 19: 39,000,235 (GRCm39) I145F probably damaging Het
Cypt4 G C 9: 24,536,770 (GRCm39) A87P probably damaging Het
Disp2 G A 2: 118,618,125 (GRCm39) V224M probably benign Het
Dlgap5 TTC T 14: 47,638,979 (GRCm39) probably null Het
Dock1 A G 7: 134,754,029 (GRCm39) K1602R probably benign Het
Ears2 T C 7: 121,647,562 (GRCm39) I241V probably benign Het
Eml6 T C 11: 29,752,489 (GRCm39) T975A probably damaging Het
Ephb2 T C 4: 136,388,121 (GRCm39) T660A probably benign Het
Fbxw7 G A 3: 84,872,621 (GRCm39) V268M Het
Gart A G 16: 91,433,426 (GRCm39) F289S probably damaging Het
Gmcl1 G T 6: 86,681,520 (GRCm39) N391K probably benign Het
Greb1l A C 18: 10,533,031 (GRCm39) Q975P probably damaging Het
Greb1l G T 18: 10,533,032 (GRCm39) Q975H probably benign Het
Grik5 C A 7: 24,710,119 (GRCm39) R872L probably damaging Het
Hmox2 T A 16: 4,582,921 (GRCm39) I218N probably damaging Het
Hook1 A T 4: 95,903,089 (GRCm39) D526V probably damaging Het
Ifna4 A T 4: 88,760,191 (GRCm39) N32Y probably damaging Het
Ighg2b T A 12: 113,270,492 (GRCm39) N213Y unknown Het
Itih4 G A 14: 30,623,127 (GRCm39) V900I probably benign Het
Itpr2 A T 6: 146,274,671 (GRCm39) F837Y probably damaging Het
Kif3a T C 11: 53,469,941 (GRCm39) V147A probably benign Het
Klra9 T A 6: 130,168,284 (GRCm39) probably benign Het
Lamp3 G T 16: 19,492,210 (GRCm39) Q345K probably benign Het
Ltbp3 G A 19: 5,807,822 (GRCm39) E1188K probably damaging Het
Med1 T A 11: 98,049,243 (GRCm39) I518L probably benign Het
Mis18bp1 T C 12: 65,205,447 (GRCm39) T242A probably damaging Het
Nemp1 T A 10: 127,532,123 (GRCm39) F392Y probably benign Het
Obscn C A 11: 58,951,802 (GRCm39) G3984W probably damaging Het
Obscn T A 11: 58,960,660 (GRCm39) H3217L possibly damaging Het
Or10ak7 A G 4: 118,791,823 (GRCm39) M74T probably benign Het
Or13j1 A G 4: 43,706,464 (GRCm39) Y35H probably damaging Het
Or2d3b C T 7: 106,514,136 (GRCm39) H244Y probably damaging Het
Or2d3c T C 7: 106,526,049 (GRCm39) I206V probably benign Het
Or5l14 C T 2: 87,792,802 (GRCm39) V145M possibly damaging Het
P4ha1 G T 10: 59,186,294 (GRCm39) A258S probably benign Het
Parn T C 16: 13,425,145 (GRCm39) I423V probably benign Het
Pcdh20 C A 14: 88,704,744 (GRCm39) S852I probably damaging Het
Pcnx3 A G 19: 5,722,784 (GRCm39) probably null Het
Pcsk1 A T 13: 75,260,769 (GRCm39) I331F probably damaging Het
Pkd1l2 G T 8: 117,748,761 (GRCm39) S1803R probably benign Het
Pkd1l3 C A 8: 110,387,433 (GRCm39) N1792K probably damaging Het
Plekhg1 C A 10: 3,913,469 (GRCm39) Q1119K Het
Prr30 T A 14: 101,436,371 (GRCm39) T64S probably benign Het
Rec114 T C 9: 58,567,653 (GRCm39) N111S probably benign Het
Reck G A 4: 43,895,850 (GRCm39) V79I probably benign Het
Rexo1 A G 10: 80,386,231 (GRCm39) F276L probably damaging Het
Rgs6 T C 12: 83,138,553 (GRCm39) Y296H probably damaging Het
Sdk1 A G 5: 142,197,793 (GRCm39) R2149G probably benign Het
Slc20a2 C A 8: 23,025,398 (GRCm39) F33L probably damaging Het
Spopl T A 2: 23,435,461 (GRCm39) T25S probably damaging Het
Srcap A T 7: 127,148,492 (GRCm39) I1947F possibly damaging Het
Srek1 A C 13: 103,881,291 (GRCm39) probably null Het
St8sia1 C T 6: 142,774,978 (GRCm39) W200* probably null Het
Tas2r106 A T 6: 131,655,465 (GRCm39) F129I possibly damaging Het
Tbrg4 A T 11: 6,570,857 (GRCm39) L205Q probably damaging Het
Tchh C A 3: 93,353,187 (GRCm39) R876S unknown Het
Thap12 G T 7: 98,364,245 (GRCm39) A138S probably benign Het
Tjp1 C T 7: 64,993,362 (GRCm39) probably null Het
Traf4 G A 11: 78,052,360 (GRCm39) P95L probably benign Het
Trappc9 ATCTC ATCTCTC 15: 72,903,447 (GRCm39) probably null Het
Usp20 G A 2: 30,907,498 (GRCm39) V677M possibly damaging Het
Usp50 C A 2: 126,625,236 (GRCm39) probably benign Het
Vmn1r21 T C 6: 57,821,307 (GRCm39) T46A probably benign Het
Vmn2r54 T A 7: 12,363,669 (GRCm39) H408L probably benign Het
Zfp266 T C 9: 20,417,299 (GRCm39) T30A probably benign Het
Other mutations in Zfp536
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01075:Zfp536 APN 7 37,267,315 (GRCm39) missense probably damaging 0.99
IGL02729:Zfp536 APN 7 37,193,143 (GRCm39) missense probably damaging 1.00
R0211:Zfp536 UTSW 7 37,267,874 (GRCm39) missense probably damaging 1.00
R0369:Zfp536 UTSW 7 37,267,373 (GRCm39) missense probably damaging 1.00
R0504:Zfp536 UTSW 7 37,268,243 (GRCm39) missense probably damaging 1.00
R0554:Zfp536 UTSW 7 37,180,244 (GRCm39) missense probably damaging 1.00
R1171:Zfp536 UTSW 7 37,269,059 (GRCm39) missense probably damaging 1.00
R1462:Zfp536 UTSW 7 37,178,735 (GRCm39) missense probably damaging 1.00
R1462:Zfp536 UTSW 7 37,178,735 (GRCm39) missense probably damaging 1.00
R1699:Zfp536 UTSW 7 37,268,879 (GRCm39) missense probably damaging 1.00
R1817:Zfp536 UTSW 7 37,268,042 (GRCm39) missense probably damaging 1.00
R1918:Zfp536 UTSW 7 37,179,624 (GRCm39) missense probably damaging 1.00
R2252:Zfp536 UTSW 7 37,178,814 (GRCm39) missense probably benign 0.30
R2288:Zfp536 UTSW 7 37,179,773 (GRCm39) missense probably damaging 0.98
R2509:Zfp536 UTSW 7 37,267,403 (GRCm39) missense possibly damaging 0.87
R3967:Zfp536 UTSW 7 37,173,255 (GRCm39) makesense probably null
R4039:Zfp536 UTSW 7 37,268,975 (GRCm39) missense probably damaging 1.00
R4600:Zfp536 UTSW 7 37,267,918 (GRCm39) missense probably damaging 1.00
R4706:Zfp536 UTSW 7 37,268,891 (GRCm39) missense probably damaging 1.00
R4771:Zfp536 UTSW 7 37,268,309 (GRCm39) missense probably damaging 1.00
R4808:Zfp536 UTSW 7 37,178,730 (GRCm39) missense probably damaging 1.00
R4945:Zfp536 UTSW 7 37,269,161 (GRCm39) missense probably damaging 1.00
R5196:Zfp536 UTSW 7 37,180,185 (GRCm39) missense probably damaging 1.00
R5506:Zfp536 UTSW 7 37,268,217 (GRCm39) missense probably damaging 1.00
R5816:Zfp536 UTSW 7 37,180,053 (GRCm39) missense probably damaging 1.00
R6114:Zfp536 UTSW 7 37,179,161 (GRCm39) missense probably damaging 0.99
R6131:Zfp536 UTSW 7 37,269,137 (GRCm39) missense probably damaging 1.00
R6156:Zfp536 UTSW 7 37,173,281 (GRCm39) missense unknown
R6257:Zfp536 UTSW 7 37,179,830 (GRCm39) missense probably damaging 1.00
R6864:Zfp536 UTSW 7 37,267,940 (GRCm39) missense probably damaging 1.00
R6975:Zfp536 UTSW 7 37,267,952 (GRCm39) missense probably damaging 1.00
R6976:Zfp536 UTSW 7 37,179,828 (GRCm39) missense probably damaging 1.00
R7176:Zfp536 UTSW 7 37,180,276 (GRCm39) critical splice acceptor site probably null
R7247:Zfp536 UTSW 7 37,268,631 (GRCm39) missense probably benign 0.04
R7325:Zfp536 UTSW 7 37,179,285 (GRCm39) missense probably benign
R7650:Zfp536 UTSW 7 37,269,117 (GRCm39) missense probably damaging 1.00
R7782:Zfp536 UTSW 7 37,268,126 (GRCm39) missense probably damaging 1.00
R7827:Zfp536 UTSW 7 37,269,113 (GRCm39) missense probably damaging 1.00
R8013:Zfp536 UTSW 7 37,269,035 (GRCm39) missense probably damaging 1.00
R8209:Zfp536 UTSW 7 37,268,080 (GRCm39) missense probably benign 0.00
R8504:Zfp536 UTSW 7 37,179,492 (GRCm39) missense probably benign
R8779:Zfp536 UTSW 7 37,267,692 (GRCm39) nonsense probably null
R8931:Zfp536 UTSW 7 37,268,721 (GRCm39) missense probably benign 0.41
R8985:Zfp536 UTSW 7 37,268,228 (GRCm39) missense probably damaging 1.00
X0066:Zfp536 UTSW 7 37,269,206 (GRCm39) missense possibly damaging 0.93
Z1176:Zfp536 UTSW 7 37,193,237 (GRCm39) missense possibly damaging 0.85
Z1186:Zfp536 UTSW 7 37,179,908 (GRCm39) missense probably benign
Z1186:Zfp536 UTSW 7 37,179,498 (GRCm39) missense probably benign
Z1186:Zfp536 UTSW 7 37,178,985 (GRCm39) missense probably benign 0.07
Z1191:Zfp536 UTSW 7 37,179,908 (GRCm39) missense probably benign
Z1191:Zfp536 UTSW 7 37,179,498 (GRCm39) missense probably benign
Z1191:Zfp536 UTSW 7 37,178,985 (GRCm39) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CTTGGGCTAAAGGTGAGACC -3'
(R):5'- CAGCCAAAGAGACTCTAGGG -3'

Sequencing Primer
(F):5'- CTAAAGGTGAGACCAGTCCCTG -3'
(R):5'- GGGACCCGAAGAGTGGTC -3'
Posted On 2019-06-07