Incidental Mutation 'PIT4453001:Adgre5'
ID555326
Institutional Source Beutler Lab
Gene Symbol Adgre5
Ensembl Gene ENSMUSG00000002885
Gene Nameadhesion G protein-coupled receptor E5
SynonymsCd97, EGF-TM7 receptor
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4453001 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location83723251-83741326 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83724460 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 713 (M713L)
Ref Sequence ENSEMBL: ENSMUSP00000075240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002964] [ENSMUST00000019576] [ENSMUST00000075843] [ENSMUST00000109802] [ENSMUST00000109810] [ENSMUST00000140521] [ENSMUST00000166939] [ENSMUST00000172396] [ENSMUST00000212949]
Predicted Effect probably benign
Transcript: ENSMUST00000002964
AA Change: M619L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000002964
Gene: ENSMUSG00000002885
AA Change: M619L

DomainStartEndE-ValueType
EGF 30 68 1.63e1 SMART
EGF_CA 69 119 5.92e-8 SMART
EGF_CA 120 167 1.78e-11 SMART
GPS 384 430 2.18e-8 SMART
Pfam:Dicty_CAR 431 703 1.3e-8 PFAM
Pfam:7tm_2 432 672 8.1e-68 PFAM
low complexity region 704 714 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000019576
SMART Domains Protein: ENSMUSP00000019576
Gene: ENSMUSG00000005481

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
DEXDc 63 264 4.06e-54 SMART
HELICc 300 381 9.09e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075843
AA Change: M713L

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000075240
Gene: ENSMUSG00000002885
AA Change: M713L

DomainStartEndE-ValueType
EGF 30 68 1.63e1 SMART
EGF_CA 69 119 5.92e-8 SMART
EGF_CA 165 213 1.38e-8 SMART
EGF_CA 214 261 1.78e-11 SMART
GPS 478 524 2.18e-8 SMART
Pfam:Dicty_CAR 525 798 4.6e-8 PFAM
Pfam:7tm_2 526 766 5.3e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109802
AA Change: M668L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000105427
Gene: ENSMUSG00000002885
AA Change: M668L

DomainStartEndE-ValueType
EGF 30 68 1.63e1 SMART
EGF_CA 69 119 5.92e-8 SMART
EGF_CA 120 168 1.38e-8 SMART
EGF_CA 169 216 1.78e-11 SMART
GPS 433 479 2.18e-8 SMART
Pfam:Dicty_CAR 480 752 5.3e-8 PFAM
Pfam:7tm_2 481 721 7.5e-67 PFAM
low complexity region 753 763 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109810
SMART Domains Protein: ENSMUSP00000105435
Gene: ENSMUSG00000005481

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
DEXDc 63 264 4.06e-54 SMART
HELICc 300 381 9.09e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140521
SMART Domains Protein: ENSMUSP00000116101
Gene: ENSMUSG00000005481

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
DEXDc 63 208 2.82e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166939
AA Change: M617L

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000128220
Gene: ENSMUSG00000002885
AA Change: M617L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
EGF 28 66 1.63e1 SMART
EGF_CA 67 117 5.92e-8 SMART
EGF_CA 118 165 1.78e-11 SMART
GPS 382 428 2.18e-8 SMART
Pfam:Dicty_CAR 429 701 2.1e-7 PFAM
Pfam:7tm_2 430 670 1.7e-66 PFAM
low complexity region 702 712 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000172396
SMART Domains Protein: ENSMUSP00000132222
Gene: ENSMUSG00000005481

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
DEXDc 63 264 4.06e-54 SMART
HELICc 300 381 9.09e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212949
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.9%
  • 10x: 85.6%
  • 20x: 74.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the EGF-TM7 subfamily of adhesion G protein-coupled receptors, which mediate cell-cell interactions. These proteins are cleaved by self-catalytic proteolysis into a large extracellular subunit and seven-span transmembrane subunit, which associate at the cell surface as a receptor complex. The encoded protein may play a role in cell adhesion as well as leukocyte recruitment, activation and migration, and contains multiple extracellular EGF-like repeats which mediate binding to chondroitin sulfate and the cell surface complement regulatory protein CD55. Expression of this gene may play a role in the progression of several types of cancer. Alternatively spliced transcript variants encoding multiple isoforms with 3 to 5 EGF-like repeats have been observed for this gene. This gene is found in a cluster with other EGF-TM7 genes on the short arm of chromosome 19. [provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype apart from mild granulocytosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T G 3: 122,105,316 I649S probably damaging Het
Abcc2 T A 19: 43,803,782 L334* probably null Het
Adam28 A T 14: 68,634,876 S306T probably benign Het
Adam34 T A 8: 43,651,312 D432V probably damaging Het
Adcy7 A G 8: 88,323,636 Y723C probably benign Het
Aebp2 C A 6: 140,637,686 C295* probably null Het
Amn1 G T 6: 149,170,859 Q127K probably benign Het
Atcay C T 10: 81,210,549 V314M probably damaging Het
Atp1a1 T C 3: 101,581,179 E847G probably benign Het
Atp2b1 A G 10: 99,016,978 E1039G probably benign Het
Caskin1 A G 17: 24,499,292 Y292C probably damaging Het
Cftr A G 6: 18,214,106 T94A probably damaging Het
Ciart T A 3: 95,880,476 K182M probably damaging Het
Col1a2 A C 6: 4,527,079 S603R possibly damaging Het
Cspp1 C A 1: 10,074,872 S298R possibly damaging Het
Cul7 T A 17: 46,651,820 C126S probably damaging Het
Cyp2c55 A T 19: 39,011,791 I145F probably damaging Het
Cypt4 G C 9: 24,625,474 A87P probably damaging Het
Disp2 G A 2: 118,787,644 V224M probably benign Het
Dlgap5 TTC T 14: 47,401,522 probably null Het
Dock1 A G 7: 135,152,300 K1602R probably benign Het
Ears2 T C 7: 122,048,339 I241V probably benign Het
Eml6 T C 11: 29,802,489 T975A probably damaging Het
Ephb2 T C 4: 136,660,810 T660A probably benign Het
Fbxw7 G A 3: 84,965,314 V268M Het
Gart A G 16: 91,636,538 F289S probably damaging Het
Gmcl1 G T 6: 86,704,538 N391K probably benign Het
Greb1l A C 18: 10,533,031 Q975P probably damaging Het
Greb1l G T 18: 10,533,032 Q975H probably benign Het
Grik5 C A 7: 25,010,694 R872L probably damaging Het
Hmox2 T A 16: 4,765,057 I218N probably damaging Het
Hook1 A T 4: 96,014,852 D526V probably damaging Het
Ifna4 A T 4: 88,841,954 N32Y probably damaging Het
Ighg2b T A 12: 113,306,872 N213Y unknown Het
Itih4 G A 14: 30,901,170 V900I probably benign Het
Itpr2 A T 6: 146,373,173 F837Y probably damaging Het
Kif3a T C 11: 53,579,114 V147A probably benign Het
Klra9 T A 6: 130,191,321 probably benign Het
Lamp3 G T 16: 19,673,460 Q345K probably benign Het
Ltbp3 G A 19: 5,757,794 E1188K probably damaging Het
Med1 T A 11: 98,158,417 I518L probably benign Het
Mis18bp1 T C 12: 65,158,673 T242A probably damaging Het
Nemp1 T A 10: 127,696,254 F392Y probably benign Het
Obscn C A 11: 59,060,976 G3984W probably damaging Het
Obscn T A 11: 59,069,834 H3217L possibly damaging Het
Olfr1157 C T 2: 87,962,458 V145M possibly damaging Het
Olfr1328 A G 4: 118,934,626 M74T probably benign Het
Olfr1532-ps1 C T 7: 106,914,929 H244Y probably damaging Het
Olfr709-ps1 T C 7: 106,926,842 I206V probably benign Het
Olfr71 A G 4: 43,706,464 Y35H probably damaging Het
P4ha1 G T 10: 59,350,472 A258S probably benign Het
Parn T C 16: 13,607,281 I423V probably benign Het
Pcdh20 C A 14: 88,467,308 S852I probably damaging Het
Pcnx3 A G 19: 5,672,756 probably null Het
Pcsk1 A T 13: 75,112,650 I331F probably damaging Het
Pkd1l2 G T 8: 117,022,022 S1803R probably benign Het
Pkd1l3 C A 8: 109,660,801 N1792K probably damaging Het
Plekhg1 C A 10: 3,963,469 Q1119K Het
Prr30 T A 14: 101,198,935 T64S probably benign Het
Rec114 T C 9: 58,660,370 N111S probably benign Het
Reck G A 4: 43,895,850 V79I probably benign Het
Rexo1 A G 10: 80,550,397 F276L probably damaging Het
Rgs6 T C 12: 83,091,779 Y296H probably damaging Het
Sdk1 A G 5: 142,212,038 R2149G probably benign Het
Slc20a2 C A 8: 22,535,382 F33L probably damaging Het
Spopl T A 2: 23,545,449 T25S probably damaging Het
Srcap A T 7: 127,549,320 I1947F possibly damaging Het
Srek1 A C 13: 103,744,783 probably null Het
St8sia1 C T 6: 142,829,252 W200* probably null Het
Tas2r106 A T 6: 131,678,502 F129I possibly damaging Het
Tbrg4 A T 11: 6,620,857 L205Q probably damaging Het
Tchh C A 3: 93,445,880 R876S unknown Het
Thap12 G T 7: 98,715,038 A138S probably benign Het
Tjp1 C T 7: 65,343,614 probably null Het
Traf4 G A 11: 78,161,534 P95L probably benign Het
Trappc9 ATCTC ATCTCTC 15: 73,031,598 probably null Het
Usp20 G A 2: 31,017,486 V677M possibly damaging Het
Usp50 C A 2: 126,783,316 probably benign Het
Vmn1r21 T C 6: 57,844,322 T46A probably benign Het
Vmn2r54 T A 7: 12,629,742 H408L probably benign Het
Zfp266 T C 9: 20,506,003 T30A probably benign Het
Zfp536 T C 7: 37,479,757 H1141R probably benign Het
Other mutations in Adgre5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Adgre5 APN 8 83728401 missense probably benign 0.01
IGL01365:Adgre5 APN 8 83723889 intron probably null
IGL01661:Adgre5 APN 8 83727935 missense probably damaging 0.99
IGL01707:Adgre5 APN 8 83724347 missense probably damaging 1.00
IGL01760:Adgre5 APN 8 83731957 missense probably benign 0.02
IGL02207:Adgre5 APN 8 83728284 missense probably damaging 1.00
IGL02483:Adgre5 APN 8 83725253 missense probably damaging 1.00
IGL03194:Adgre5 APN 8 83734018 missense possibly damaging 0.67
R0024:Adgre5 UTSW 8 83728284 missense probably damaging 1.00
R0137:Adgre5 UTSW 8 83724898 missense probably damaging 1.00
R0257:Adgre5 UTSW 8 83731995 missense possibly damaging 0.54
R0485:Adgre5 UTSW 8 83731998 missense probably damaging 0.99
R0522:Adgre5 UTSW 8 83730176 missense probably benign 0.30
R0940:Adgre5 UTSW 8 83733497 missense probably damaging 1.00
R1372:Adgre5 UTSW 8 83728320 missense probably damaging 0.96
R1617:Adgre5 UTSW 8 83730177 missense possibly damaging 0.50
R1679:Adgre5 UTSW 8 83729405 missense probably benign 0.09
R1917:Adgre5 UTSW 8 83729109 missense probably damaging 0.99
R1918:Adgre5 UTSW 8 83729109 missense probably damaging 0.99
R2072:Adgre5 UTSW 8 83727804 missense probably benign 0.24
R2831:Adgre5 UTSW 8 83728394 missense possibly damaging 0.80
R5250:Adgre5 UTSW 8 83733440 missense probably benign
R5512:Adgre5 UTSW 8 83729086 missense probably benign
R6077:Adgre5 UTSW 8 83727966 missense probably benign
R7486:Adgre5 UTSW 8 83723886 missense probably damaging 1.00
R7733:Adgre5 UTSW 8 83729396 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AGATGTAGGATAGCCATGTGC -3'
(R):5'- TCTCTGGAGCTTTTCGGGAC -3'

Sequencing Primer
(F):5'- CATGTGCTATGGGGGTTGAAGAG -3'
(R):5'- GACCCGTGGCCTTCATC -3'
Posted On2019-06-07