Incidental Mutation 'PIT4453001:Plekhg1'
ID555333
Institutional Source Beutler Lab
Gene Symbol Plekhg1
Ensembl Gene ENSMUSG00000040624
Gene Namepleckstrin homology domain containing, family G (with RhoGef domain) member 1
SynonymsD10Ertd733e
Accession Numbers

Ncbi RefSeq: NM_001159942.1, NM_001033253.3; MGI:2676551

Is this an essential gene? Probably non essential (E-score: 0.246) question?
Stock #PIT4453001 (G1)
Quality Score109.008
Status Not validated
Chromosome10
Chromosomal Location3740364-3967303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 3963469 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 1119 (Q1119K)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042438] [ENSMUST00000120274]
Predicted Effect probably benign
Transcript: ENSMUST00000042438
AA Change: Q1064K

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000040495
Gene: ENSMUSG00000040624
AA Change: Q1064K

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
RhoGEF 116 291 4.17e-52 SMART
PH 323 417 2.54e-6 SMART
low complexity region 419 431 N/A INTRINSIC
low complexity region 1151 1162 N/A INTRINSIC
low complexity region 1186 1197 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120274
AA Change: Q1064K

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000114056
Gene: ENSMUSG00000040624
AA Change: Q1064K

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
RhoGEF 116 291 4.17e-52 SMART
PH 323 417 2.54e-6 SMART
low complexity region 419 431 N/A INTRINSIC
low complexity region 1151 1162 N/A INTRINSIC
low complexity region 1186 1197 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000119950
Gene: ENSMUSG00000040624
AA Change: Q1119K

DomainStartEndE-ValueType
low complexity region 67 86 N/A INTRINSIC
RhoGEF 172 347 4.17e-52 SMART
PH 379 473 2.54e-6 SMART
low complexity region 475 487 N/A INTRINSIC
low complexity region 1207 1218 N/A INTRINSIC
low complexity region 1242 1253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141367
Predicted Effect
SMART Domains Protein: ENSMUSP00000122131
Gene: ENSMUSG00000040624
AA Change: Q918K

DomainStartEndE-ValueType
RhoGEF 4 146 2.25e-25 SMART
PH 178 272 2.54e-6 SMART
low complexity region 274 286 N/A INTRINSIC
low complexity region 1006 1017 N/A INTRINSIC
low complexity region 1041 1052 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.9%
  • 10x: 85.6%
  • 20x: 74.1%
Validation Efficiency
Allele List at MGI

All alleles(13) : Targeted(2) Gene trapped(11)

Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T G 3: 122,105,316 I649S probably damaging Het
Abcc2 T A 19: 43,803,782 L334* probably null Het
Adam28 A T 14: 68,634,876 S306T probably benign Het
Adam34 T A 8: 43,651,312 D432V probably damaging Het
Adcy7 A G 8: 88,323,636 Y723C probably benign Het
Adgre5 T A 8: 83,724,460 M713L probably benign Het
Aebp2 C A 6: 140,637,686 C295* probably null Het
Amn1 G T 6: 149,170,859 Q127K probably benign Het
Atcay C T 10: 81,210,549 V314M probably damaging Het
Atp1a1 T C 3: 101,581,179 E847G probably benign Het
Atp2b1 A G 10: 99,016,978 E1039G probably benign Het
Caskin1 A G 17: 24,499,292 Y292C probably damaging Het
Cftr A G 6: 18,214,106 T94A probably damaging Het
Ciart T A 3: 95,880,476 K182M probably damaging Het
Col1a2 A C 6: 4,527,079 S603R possibly damaging Het
Cspp1 C A 1: 10,074,872 S298R possibly damaging Het
Cul7 T A 17: 46,651,820 C126S probably damaging Het
Cyp2c55 A T 19: 39,011,791 I145F probably damaging Het
Cypt4 G C 9: 24,625,474 A87P probably damaging Het
Disp2 G A 2: 118,787,644 V224M probably benign Het
Dlgap5 TTC T 14: 47,401,522 probably null Het
Dock1 A G 7: 135,152,300 K1602R probably benign Het
Ears2 T C 7: 122,048,339 I241V probably benign Het
Eml6 T C 11: 29,802,489 T975A probably damaging Het
Ephb2 T C 4: 136,660,810 T660A probably benign Het
Fbxw7 G A 3: 84,965,314 V268M Het
Gart A G 16: 91,636,538 F289S probably damaging Het
Gmcl1 G T 6: 86,704,538 N391K probably benign Het
Greb1l A C 18: 10,533,031 Q975P probably damaging Het
Greb1l G T 18: 10,533,032 Q975H probably benign Het
Grik5 C A 7: 25,010,694 R872L probably damaging Het
Hmox2 T A 16: 4,765,057 I218N probably damaging Het
Hook1 A T 4: 96,014,852 D526V probably damaging Het
Ifna4 A T 4: 88,841,954 N32Y probably damaging Het
Ighg2b T A 12: 113,306,872 N213Y unknown Het
Itih4 G A 14: 30,901,170 V900I probably benign Het
Itpr2 A T 6: 146,373,173 F837Y probably damaging Het
Kif3a T C 11: 53,579,114 V147A probably benign Het
Klra9 T A 6: 130,191,321 probably benign Het
Lamp3 G T 16: 19,673,460 Q345K probably benign Het
Ltbp3 G A 19: 5,757,794 E1188K probably damaging Het
Med1 T A 11: 98,158,417 I518L probably benign Het
Mis18bp1 T C 12: 65,158,673 T242A probably damaging Het
Nemp1 T A 10: 127,696,254 F392Y probably benign Het
Obscn C A 11: 59,060,976 G3984W probably damaging Het
Obscn T A 11: 59,069,834 H3217L possibly damaging Het
Olfr1157 C T 2: 87,962,458 V145M possibly damaging Het
Olfr1328 A G 4: 118,934,626 M74T probably benign Het
Olfr1532-ps1 C T 7: 106,914,929 H244Y probably damaging Het
Olfr709-ps1 T C 7: 106,926,842 I206V probably benign Het
Olfr71 A G 4: 43,706,464 Y35H probably damaging Het
P4ha1 G T 10: 59,350,472 A258S probably benign Het
Parn T C 16: 13,607,281 I423V probably benign Het
Pcdh20 C A 14: 88,467,308 S852I probably damaging Het
Pcnx3 A G 19: 5,672,756 probably null Het
Pcsk1 A T 13: 75,112,650 I331F probably damaging Het
Pkd1l2 G T 8: 117,022,022 S1803R probably benign Het
Pkd1l3 C A 8: 109,660,801 N1792K probably damaging Het
Prr30 T A 14: 101,198,935 T64S probably benign Het
Rec114 T C 9: 58,660,370 N111S probably benign Het
Reck G A 4: 43,895,850 V79I probably benign Het
Rexo1 A G 10: 80,550,397 F276L probably damaging Het
Rgs6 T C 12: 83,091,779 Y296H probably damaging Het
Sdk1 A G 5: 142,212,038 R2149G probably benign Het
Slc20a2 C A 8: 22,535,382 F33L probably damaging Het
Spopl T A 2: 23,545,449 T25S probably damaging Het
Srcap A T 7: 127,549,320 I1947F possibly damaging Het
Srek1 A C 13: 103,744,783 probably null Het
St8sia1 C T 6: 142,829,252 W200* probably null Het
Tas2r106 A T 6: 131,678,502 F129I possibly damaging Het
Tbrg4 A T 11: 6,620,857 L205Q probably damaging Het
Tchh C A 3: 93,445,880 R876S unknown Het
Thap12 G T 7: 98,715,038 A138S probably benign Het
Tjp1 C T 7: 65,343,614 probably null Het
Traf4 G A 11: 78,161,534 P95L probably benign Het
Trappc9 ATCTC ATCTCTC 15: 73,031,598 probably null Het
Usp20 G A 2: 31,017,486 V677M possibly damaging Het
Usp50 C A 2: 126,783,316 probably benign Het
Vmn1r21 T C 6: 57,844,322 T46A probably benign Het
Vmn2r54 T A 7: 12,629,742 H408L probably benign Het
Zfp266 T C 9: 20,506,003 T30A probably benign Het
Zfp536 T C 7: 37,479,757 H1141R probably benign Het
Other mutations in Plekhg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01589:Plekhg1 APN 10 3963631 missense probably benign 0.02
IGL01639:Plekhg1 APN 10 3956751 missense probably damaging 0.98
IGL01766:Plekhg1 APN 10 3873400 missense probably damaging 1.00
IGL01983:Plekhg1 APN 10 3945904 missense probably damaging 1.00
IGL02226:Plekhg1 APN 10 3945916 missense probably damaging 0.99
IGL02420:Plekhg1 APN 10 3964106 missense probably damaging 1.00
IGL02441:Plekhg1 APN 10 3958103 missense possibly damaging 0.89
IGL02505:Plekhg1 APN 10 3957139 missense probably damaging 0.97
IGL02659:Plekhg1 APN 10 3957069 nonsense probably null
IGL02730:Plekhg1 APN 10 3873242 missense possibly damaging 0.59
BB006:Plekhg1 UTSW 10 3919170 missense probably damaging 0.99
BB016:Plekhg1 UTSW 10 3919170 missense probably damaging 0.99
R0041:Plekhg1 UTSW 10 3964076 nonsense probably null
R0041:Plekhg1 UTSW 10 3964074 missense probably benign 0.02
R0068:Plekhg1 UTSW 10 3940504 nonsense probably null
R0068:Plekhg1 UTSW 10 3940502 missense probably damaging 0.99
R0333:Plekhg1 UTSW 10 3964419 missense probably damaging 1.00
R0427:Plekhg1 UTSW 10 3964235 missense probably benign 0.01
R0499:Plekhg1 UTSW 10 3937971 missense probably damaging 1.00
R0504:Plekhg1 UTSW 10 3937853 missense probably damaging 1.00
R1499:Plekhg1 UTSW 10 3940538 splice site probably benign
R1501:Plekhg1 UTSW 10 3957361 missense probably benign 0.02
R1565:Plekhg1 UTSW 10 3940526 missense probably damaging 1.00
R1801:Plekhg1 UTSW 10 3963904 missense probably damaging 1.00
R1823:Plekhg1 UTSW 10 3903658 critical splice donor site probably null
R1858:Plekhg1 UTSW 10 3945917 missense possibly damaging 0.95
R1984:Plekhg1 UTSW 10 3958181 missense probably damaging 1.00
R2420:Plekhg1 UTSW 10 3958048 missense probably benign 0.39
R2421:Plekhg1 UTSW 10 3958048 missense probably benign 0.39
R2422:Plekhg1 UTSW 10 3958048 missense probably benign 0.39
R2437:Plekhg1 UTSW 10 3963564 missense probably damaging 1.00
R2872:Plekhg1 UTSW 10 3963982 missense probably benign
R2872:Plekhg1 UTSW 10 3963982 missense probably benign
R3830:Plekhg1 UTSW 10 3873400 missense probably damaging 1.00
R4058:Plekhg1 UTSW 10 3957087 missense probably damaging 1.00
R4059:Plekhg1 UTSW 10 3957087 missense probably damaging 1.00
R4649:Plekhg1 UTSW 10 3956985 missense probably benign 0.00
R4731:Plekhg1 UTSW 10 3957506 missense probably benign 0.01
R4732:Plekhg1 UTSW 10 3957506 missense probably benign 0.01
R4733:Plekhg1 UTSW 10 3957506 missense probably benign 0.01
R4772:Plekhg1 UTSW 10 3873127 missense probably benign 0.00
R4772:Plekhg1 UTSW 10 3873130 missense probably damaging 1.00
R4803:Plekhg1 UTSW 10 3957186 missense probably benign 0.02
R5086:Plekhg1 UTSW 10 3903649 missense probably damaging 1.00
R5175:Plekhg1 UTSW 10 3965516 unclassified probably benign
R5283:Plekhg1 UTSW 10 3956654 missense probably benign 0.00
R5862:Plekhg1 UTSW 10 3937914 missense probably damaging 1.00
R6163:Plekhg1 UTSW 10 3964369 missense probably damaging 1.00
R6564:Plekhg1 UTSW 10 3964153 missense probably damaging 1.00
R6700:Plekhg1 UTSW 10 3957373 missense probably benign
R6930:Plekhg1 UTSW 10 3963770 missense possibly damaging 0.56
R7033:Plekhg1 UTSW 10 3940251 missense probably damaging 0.97
R7200:Plekhg1 UTSW 10 3956810 missense
R7223:Plekhg1 UTSW 10 3873343 missense
R7353:Plekhg1 UTSW 10 3964327 missense
R7488:Plekhg1 UTSW 10 3957491 missense
R7554:Plekhg1 UTSW 10 3963647 missense
R7929:Plekhg1 UTSW 10 3919170 missense probably damaging 0.99
R8014:Plekhg1 UTSW 10 3957758 missense
R8104:Plekhg1 UTSW 10 3952326 missense
R8167:Plekhg1 UTSW 10 3957452 missense
R8167:Plekhg1 UTSW 10 3957453 missense
R8215:Plekhg1 UTSW 10 3957521 missense
R8263:Plekhg1 UTSW 10 3957651 missense
Predicted Primers PCR Primer
(F):5'- GGCATTTAGTGACTACTCCCC -3'
(R):5'- CTGATTGCTTTGCGACCCAG -3'

Sequencing Primer
(F):5'- CATTTAGTGACTACTCCCCTTTAATC -3'
(R):5'- AGAGGACTCTGACCTGAGTTC -3'
Posted On2019-06-07