Incidental Mutation 'PIT4453001:Rexo1'
ID555335
Institutional Source Beutler Lab
Gene Symbol Rexo1
Ensembl Gene ENSMUSG00000047417
Gene NameREX1, RNA exonuclease 1
Synonyms2610511M11Rik, Tceb3bp1, 1700021P10Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.248) question?
Stock #PIT4453001 (G1)
Quality Score214.009
Status Not validated
Chromosome10
Chromosomal Location80540922-80561560 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80550397 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 276 (F276L)
Ref Sequence ENSEMBL: ENSMUSP00000049705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057910]
Predicted Effect probably damaging
Transcript: ENSMUST00000057910
AA Change: F276L

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000049705
Gene: ENSMUSG00000047417
AA Change: F276L

DomainStartEndE-ValueType
low complexity region 34 53 N/A INTRINSIC
coiled coil region 83 113 N/A INTRINSIC
low complexity region 180 188 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
low complexity region 383 396 N/A INTRINSIC
low complexity region 440 453 N/A INTRINSIC
low complexity region 468 479 N/A INTRINSIC
low complexity region 507 525 N/A INTRINSIC
low complexity region 533 551 N/A INTRINSIC
low complexity region 561 583 N/A INTRINSIC
low complexity region 667 682 N/A INTRINSIC
Pfam:EloA-BP1 794 954 3.8e-72 PFAM
EXOIII 1051 1210 2.36e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182260
Predicted Effect probably benign
Transcript: ENSMUST00000183073
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.9%
  • 10x: 85.6%
  • 20x: 74.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T G 3: 122,105,316 I649S probably damaging Het
Abcc2 T A 19: 43,803,782 L334* probably null Het
Adam28 A T 14: 68,634,876 S306T probably benign Het
Adam34 T A 8: 43,651,312 D432V probably damaging Het
Adcy7 A G 8: 88,323,636 Y723C probably benign Het
Adgre5 T A 8: 83,724,460 M713L probably benign Het
Aebp2 C A 6: 140,637,686 C295* probably null Het
Amn1 G T 6: 149,170,859 Q127K probably benign Het
Atcay C T 10: 81,210,549 V314M probably damaging Het
Atp1a1 T C 3: 101,581,179 E847G probably benign Het
Atp2b1 A G 10: 99,016,978 E1039G probably benign Het
Caskin1 A G 17: 24,499,292 Y292C probably damaging Het
Cftr A G 6: 18,214,106 T94A probably damaging Het
Ciart T A 3: 95,880,476 K182M probably damaging Het
Col1a2 A C 6: 4,527,079 S603R possibly damaging Het
Cspp1 C A 1: 10,074,872 S298R possibly damaging Het
Cul7 T A 17: 46,651,820 C126S probably damaging Het
Cyp2c55 A T 19: 39,011,791 I145F probably damaging Het
Cypt4 G C 9: 24,625,474 A87P probably damaging Het
Disp2 G A 2: 118,787,644 V224M probably benign Het
Dlgap5 TTC T 14: 47,401,522 probably null Het
Dock1 A G 7: 135,152,300 K1602R probably benign Het
Ears2 T C 7: 122,048,339 I241V probably benign Het
Eml6 T C 11: 29,802,489 T975A probably damaging Het
Ephb2 T C 4: 136,660,810 T660A probably benign Het
Fbxw7 G A 3: 84,965,314 V268M Het
Gart A G 16: 91,636,538 F289S probably damaging Het
Gmcl1 G T 6: 86,704,538 N391K probably benign Het
Greb1l A C 18: 10,533,031 Q975P probably damaging Het
Greb1l G T 18: 10,533,032 Q975H probably benign Het
Grik5 C A 7: 25,010,694 R872L probably damaging Het
Hmox2 T A 16: 4,765,057 I218N probably damaging Het
Hook1 A T 4: 96,014,852 D526V probably damaging Het
Ifna4 A T 4: 88,841,954 N32Y probably damaging Het
Ighg2b T A 12: 113,306,872 N213Y unknown Het
Itih4 G A 14: 30,901,170 V900I probably benign Het
Itpr2 A T 6: 146,373,173 F837Y probably damaging Het
Kif3a T C 11: 53,579,114 V147A probably benign Het
Klra9 T A 6: 130,191,321 probably benign Het
Lamp3 G T 16: 19,673,460 Q345K probably benign Het
Ltbp3 G A 19: 5,757,794 E1188K probably damaging Het
Med1 T A 11: 98,158,417 I518L probably benign Het
Mis18bp1 T C 12: 65,158,673 T242A probably damaging Het
Nemp1 T A 10: 127,696,254 F392Y probably benign Het
Obscn C A 11: 59,060,976 G3984W probably damaging Het
Obscn T A 11: 59,069,834 H3217L possibly damaging Het
Olfr1157 C T 2: 87,962,458 V145M possibly damaging Het
Olfr1328 A G 4: 118,934,626 M74T probably benign Het
Olfr1532-ps1 C T 7: 106,914,929 H244Y probably damaging Het
Olfr709-ps1 T C 7: 106,926,842 I206V probably benign Het
Olfr71 A G 4: 43,706,464 Y35H probably damaging Het
P4ha1 G T 10: 59,350,472 A258S probably benign Het
Parn T C 16: 13,607,281 I423V probably benign Het
Pcdh20 C A 14: 88,467,308 S852I probably damaging Het
Pcnx3 A G 19: 5,672,756 probably null Het
Pcsk1 A T 13: 75,112,650 I331F probably damaging Het
Pkd1l2 G T 8: 117,022,022 S1803R probably benign Het
Pkd1l3 C A 8: 109,660,801 N1792K probably damaging Het
Plekhg1 C A 10: 3,963,469 Q1119K Het
Prr30 T A 14: 101,198,935 T64S probably benign Het
Rec114 T C 9: 58,660,370 N111S probably benign Het
Reck G A 4: 43,895,850 V79I probably benign Het
Rgs6 T C 12: 83,091,779 Y296H probably damaging Het
Sdk1 A G 5: 142,212,038 R2149G probably benign Het
Slc20a2 C A 8: 22,535,382 F33L probably damaging Het
Spopl T A 2: 23,545,449 T25S probably damaging Het
Srcap A T 7: 127,549,320 I1947F possibly damaging Het
Srek1 A C 13: 103,744,783 probably null Het
St8sia1 C T 6: 142,829,252 W200* probably null Het
Tas2r106 A T 6: 131,678,502 F129I possibly damaging Het
Tbrg4 A T 11: 6,620,857 L205Q probably damaging Het
Tchh C A 3: 93,445,880 R876S unknown Het
Thap12 G T 7: 98,715,038 A138S probably benign Het
Tjp1 C T 7: 65,343,614 probably null Het
Traf4 G A 11: 78,161,534 P95L probably benign Het
Trappc9 ATCTC ATCTCTC 15: 73,031,598 probably null Het
Usp20 G A 2: 31,017,486 V677M possibly damaging Het
Usp50 C A 2: 126,783,316 probably benign Het
Vmn1r21 T C 6: 57,844,322 T46A probably benign Het
Vmn2r54 T A 7: 12,629,742 H408L probably benign Het
Zfp266 T C 9: 20,506,003 T30A probably benign Het
Zfp536 T C 7: 37,479,757 H1141R probably benign Het
Other mutations in Rexo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Rexo1 APN 10 80550964 missense probably damaging 0.99
IGL01128:Rexo1 APN 10 80549739 missense probably benign
IGL01890:Rexo1 APN 10 80543011 missense possibly damaging 0.85
R0044:Rexo1 UTSW 10 80544378 missense probably benign 0.16
R0365:Rexo1 UTSW 10 80542576 missense probably damaging 0.99
R0573:Rexo1 UTSW 10 80544850 missense probably damaging 1.00
R1146:Rexo1 UTSW 10 80544405 missense probably benign 0.04
R1146:Rexo1 UTSW 10 80544405 missense probably benign 0.04
R1511:Rexo1 UTSW 10 80550050 missense possibly damaging 0.93
R1523:Rexo1 UTSW 10 80542751 missense probably benign 0.41
R1807:Rexo1 UTSW 10 80542579 missense possibly damaging 0.95
R1868:Rexo1 UTSW 10 80542920 missense probably damaging 1.00
R1935:Rexo1 UTSW 10 80550469 missense probably benign 0.00
R1936:Rexo1 UTSW 10 80550469 missense probably benign 0.00
R1957:Rexo1 UTSW 10 80543366 missense probably damaging 0.96
R2084:Rexo1 UTSW 10 80561266 missense probably benign 0.01
R2153:Rexo1 UTSW 10 80544109 nonsense probably null
R2262:Rexo1 UTSW 10 80549569 missense probably benign 0.02
R4471:Rexo1 UTSW 10 80542658 missense probably damaging 1.00
R4472:Rexo1 UTSW 10 80542658 missense probably damaging 1.00
R4690:Rexo1 UTSW 10 80546421 missense probably benign 0.01
R4972:Rexo1 UTSW 10 80549693 missense probably damaging 0.96
R6335:Rexo1 UTSW 10 80544081 missense probably damaging 1.00
R6505:Rexo1 UTSW 10 80543011 missense possibly damaging 0.85
R6615:Rexo1 UTSW 10 80544014 missense possibly damaging 0.68
R6949:Rexo1 UTSW 10 80550636 missense possibly damaging 0.46
R7612:Rexo1 UTSW 10 80549663 missense probably benign 0.40
R7807:Rexo1 UTSW 10 80550136 missense probably benign 0.09
R7840:Rexo1 UTSW 10 80550738 missense probably benign
Z1177:Rexo1 UTSW 10 80549775 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTTGACCACAGACACTG -3'
(R):5'- CCTTCAACAGATCTAGAGTATGACC -3'

Sequencing Primer
(F):5'- AAGGTCTTCCACGTCATACTG -3'
(R):5'- GATCTAGAGTATGACCCACTGTC -3'
Posted On2019-06-07