Incidental Mutation 'PIT4453001:Nemp1'
ID 555338
Institutional Source Beutler Lab
Gene Symbol Nemp1
Ensembl Gene ENSMUSG00000040195
Gene Name nuclear envelope integral membrane protein 1
Synonyms Tmem194
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # PIT4453001 (G1)
Quality Score 201.009
Status Not validated
Chromosome 10
Chromosomal Location 127512934-127536918 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 127532123 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 392 (F392Y)
Ref Sequence ENSEMBL: ENSMUSP00000045988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048099] [ENSMUST00000118612] [ENSMUST00000118728]
AlphaFold Q6ZQE4
Predicted Effect probably benign
Transcript: ENSMUST00000048099
AA Change: F392Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000045988
Gene: ENSMUSG00000040195
AA Change: F392Y

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:DUF2215 150 396 1.2e-94 PFAM
low complexity region 416 426 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118612
SMART Domains Protein: ENSMUSP00000113337
Gene: ENSMUSG00000040195

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:DUF2215 149 325 4.2e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118728
AA Change: F343Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113473
Gene: ENSMUSG00000040195
AA Change: F343Y

DomainStartEndE-ValueType
Pfam:DUF2215 100 348 7.2e-105 PFAM
low complexity region 367 377 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.9%
  • 10x: 85.6%
  • 20x: 74.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T G 3: 121,898,965 (GRCm39) I649S probably damaging Het
Abcc2 T A 19: 43,792,221 (GRCm39) L334* probably null Het
Adam28 A T 14: 68,872,325 (GRCm39) S306T probably benign Het
Adam34 T A 8: 44,104,349 (GRCm39) D432V probably damaging Het
Adcy7 A G 8: 89,050,264 (GRCm39) Y723C probably benign Het
Adgre5 T A 8: 84,451,089 (GRCm39) M713L probably benign Het
Aebp2 C A 6: 140,583,412 (GRCm39) C295* probably null Het
Amn1 G T 6: 149,072,357 (GRCm39) Q127K probably benign Het
Atcay C T 10: 81,046,383 (GRCm39) V314M probably damaging Het
Atp1a1 T C 3: 101,488,495 (GRCm39) E847G probably benign Het
Atp2b1 A G 10: 98,852,840 (GRCm39) E1039G probably benign Het
Caskin1 A G 17: 24,718,266 (GRCm39) Y292C probably damaging Het
Cftr A G 6: 18,214,105 (GRCm39) T94A probably damaging Het
Ciart T A 3: 95,787,788 (GRCm39) K182M probably damaging Het
Col1a2 A C 6: 4,527,079 (GRCm39) S603R possibly damaging Het
Cspp1 C A 1: 10,145,097 (GRCm39) S298R possibly damaging Het
Cul7 T A 17: 46,962,746 (GRCm39) C126S probably damaging Het
Cyp2c55 A T 19: 39,000,235 (GRCm39) I145F probably damaging Het
Cypt4 G C 9: 24,536,770 (GRCm39) A87P probably damaging Het
Disp2 G A 2: 118,618,125 (GRCm39) V224M probably benign Het
Dlgap5 TTC T 14: 47,638,979 (GRCm39) probably null Het
Dock1 A G 7: 134,754,029 (GRCm39) K1602R probably benign Het
Ears2 T C 7: 121,647,562 (GRCm39) I241V probably benign Het
Eml6 T C 11: 29,752,489 (GRCm39) T975A probably damaging Het
Ephb2 T C 4: 136,388,121 (GRCm39) T660A probably benign Het
Fbxw7 G A 3: 84,872,621 (GRCm39) V268M Het
Gart A G 16: 91,433,426 (GRCm39) F289S probably damaging Het
Gmcl1 G T 6: 86,681,520 (GRCm39) N391K probably benign Het
Greb1l A C 18: 10,533,031 (GRCm39) Q975P probably damaging Het
Greb1l G T 18: 10,533,032 (GRCm39) Q975H probably benign Het
Grik5 C A 7: 24,710,119 (GRCm39) R872L probably damaging Het
Hmox2 T A 16: 4,582,921 (GRCm39) I218N probably damaging Het
Hook1 A T 4: 95,903,089 (GRCm39) D526V probably damaging Het
Ifna4 A T 4: 88,760,191 (GRCm39) N32Y probably damaging Het
Ighg2b T A 12: 113,270,492 (GRCm39) N213Y unknown Het
Itih4 G A 14: 30,623,127 (GRCm39) V900I probably benign Het
Itpr2 A T 6: 146,274,671 (GRCm39) F837Y probably damaging Het
Kif3a T C 11: 53,469,941 (GRCm39) V147A probably benign Het
Klra9 T A 6: 130,168,284 (GRCm39) probably benign Het
Lamp3 G T 16: 19,492,210 (GRCm39) Q345K probably benign Het
Ltbp3 G A 19: 5,807,822 (GRCm39) E1188K probably damaging Het
Med1 T A 11: 98,049,243 (GRCm39) I518L probably benign Het
Mis18bp1 T C 12: 65,205,447 (GRCm39) T242A probably damaging Het
Obscn C A 11: 58,951,802 (GRCm39) G3984W probably damaging Het
Obscn T A 11: 58,960,660 (GRCm39) H3217L possibly damaging Het
Or10ak7 A G 4: 118,791,823 (GRCm39) M74T probably benign Het
Or13j1 A G 4: 43,706,464 (GRCm39) Y35H probably damaging Het
Or2d3b C T 7: 106,514,136 (GRCm39) H244Y probably damaging Het
Or2d3c T C 7: 106,526,049 (GRCm39) I206V probably benign Het
Or5l14 C T 2: 87,792,802 (GRCm39) V145M possibly damaging Het
P4ha1 G T 10: 59,186,294 (GRCm39) A258S probably benign Het
Parn T C 16: 13,425,145 (GRCm39) I423V probably benign Het
Pcdh20 C A 14: 88,704,744 (GRCm39) S852I probably damaging Het
Pcnx3 A G 19: 5,722,784 (GRCm39) probably null Het
Pcsk1 A T 13: 75,260,769 (GRCm39) I331F probably damaging Het
Pkd1l2 G T 8: 117,748,761 (GRCm39) S1803R probably benign Het
Pkd1l3 C A 8: 110,387,433 (GRCm39) N1792K probably damaging Het
Plekhg1 C A 10: 3,913,469 (GRCm39) Q1119K Het
Prr30 T A 14: 101,436,371 (GRCm39) T64S probably benign Het
Rec114 T C 9: 58,567,653 (GRCm39) N111S probably benign Het
Reck G A 4: 43,895,850 (GRCm39) V79I probably benign Het
Rexo1 A G 10: 80,386,231 (GRCm39) F276L probably damaging Het
Rgs6 T C 12: 83,138,553 (GRCm39) Y296H probably damaging Het
Sdk1 A G 5: 142,197,793 (GRCm39) R2149G probably benign Het
Slc20a2 C A 8: 23,025,398 (GRCm39) F33L probably damaging Het
Spopl T A 2: 23,435,461 (GRCm39) T25S probably damaging Het
Srcap A T 7: 127,148,492 (GRCm39) I1947F possibly damaging Het
Srek1 A C 13: 103,881,291 (GRCm39) probably null Het
St8sia1 C T 6: 142,774,978 (GRCm39) W200* probably null Het
Tas2r106 A T 6: 131,655,465 (GRCm39) F129I possibly damaging Het
Tbrg4 A T 11: 6,570,857 (GRCm39) L205Q probably damaging Het
Tchh C A 3: 93,353,187 (GRCm39) R876S unknown Het
Thap12 G T 7: 98,364,245 (GRCm39) A138S probably benign Het
Tjp1 C T 7: 64,993,362 (GRCm39) probably null Het
Traf4 G A 11: 78,052,360 (GRCm39) P95L probably benign Het
Trappc9 ATCTC ATCTCTC 15: 72,903,447 (GRCm39) probably null Het
Usp20 G A 2: 30,907,498 (GRCm39) V677M possibly damaging Het
Usp50 C A 2: 126,625,236 (GRCm39) probably benign Het
Vmn1r21 T C 6: 57,821,307 (GRCm39) T46A probably benign Het
Vmn2r54 T A 7: 12,363,669 (GRCm39) H408L probably benign Het
Zfp266 T C 9: 20,417,299 (GRCm39) T30A probably benign Het
Zfp536 T C 7: 37,179,182 (GRCm39) H1141R probably benign Het
Other mutations in Nemp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02172:Nemp1 APN 10 127,528,868 (GRCm39) missense probably benign 0.02
Assassin UTSW 10 127,525,212 (GRCm39) nonsense probably null
Brightside UTSW 10 127,525,319 (GRCm39) splice site probably null
Cheery UTSW 10 127,513,067 (GRCm39) missense possibly damaging 0.86
kidon UTSW 10 127,525,227 (GRCm39) missense possibly damaging 0.85
R0815:Nemp1 UTSW 10 127,528,893 (GRCm39) missense probably damaging 0.99
R1719:Nemp1 UTSW 10 127,532,117 (GRCm39) missense probably damaging 1.00
R2007:Nemp1 UTSW 10 127,529,446 (GRCm39) missense probably benign 0.02
R2042:Nemp1 UTSW 10 127,532,203 (GRCm39) missense possibly damaging 0.46
R3938:Nemp1 UTSW 10 127,531,342 (GRCm39) missense probably damaging 1.00
R4548:Nemp1 UTSW 10 127,532,213 (GRCm39) missense probably benign 0.00
R4726:Nemp1 UTSW 10 127,530,462 (GRCm39) missense probably benign 0.01
R4981:Nemp1 UTSW 10 127,529,399 (GRCm39) missense probably damaging 1.00
R5048:Nemp1 UTSW 10 127,526,804 (GRCm39) critical splice donor site probably null
R5784:Nemp1 UTSW 10 127,513,067 (GRCm39) missense possibly damaging 0.86
R6073:Nemp1 UTSW 10 127,525,112 (GRCm39) missense probably benign 0.01
R6171:Nemp1 UTSW 10 127,525,319 (GRCm39) splice site probably null
R6294:Nemp1 UTSW 10 127,530,391 (GRCm39) missense possibly damaging 0.87
R7249:Nemp1 UTSW 10 127,529,395 (GRCm39) missense probably damaging 1.00
R7269:Nemp1 UTSW 10 127,531,345 (GRCm39) missense probably damaging 1.00
R7316:Nemp1 UTSW 10 127,525,212 (GRCm39) nonsense probably null
R7468:Nemp1 UTSW 10 127,528,923 (GRCm39) missense possibly damaging 0.56
R7998:Nemp1 UTSW 10 127,529,358 (GRCm39) missense probably damaging 1.00
R8342:Nemp1 UTSW 10 127,528,898 (GRCm39) missense probably benign 0.00
R8672:Nemp1 UTSW 10 127,512,988 (GRCm39) missense probably benign
R8756:Nemp1 UTSW 10 127,528,845 (GRCm39) missense probably benign 0.30
R9228:Nemp1 UTSW 10 127,525,227 (GRCm39) missense possibly damaging 0.85
R9749:Nemp1 UTSW 10 127,524,198 (GRCm39) missense probably benign 0.44
X0011:Nemp1 UTSW 10 127,525,180 (GRCm39) nonsense probably null
Z1177:Nemp1 UTSW 10 127,529,388 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTCAGTCTATGCATCTGCCG -3'
(R):5'- TGGGAGAATCACACAGCACTTAC -3'

Sequencing Primer
(F):5'- CGAAGCAAGGGCAGGACTTTG -3'
(R):5'- CAAGGTACCATGCCAGTCTATATG -3'
Posted On 2019-06-07