Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4453001:Eml6'

555340

Institutional Source

Beutler Lab

Gene Symbol

Eml6

Ensembl Gene

ENSMUSG00000044072

Gene Name

echinoderm microtubule associated protein like 6

Synonyms

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.213) question?

Stock #

PIT4453001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

29743048-30026033 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 29802489 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 975 (T975A)

Ref Sequence

ENSEMBL: ENSMUSP00000051080 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058902]

AlphaFold

Q5SQM0

Predicted Effect

probably damaging
Transcript: ENSMUST00000058902
AA Change: T975A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000051080
Gene: ENSMUSG00000044072
AA Change: T975A

Domain	Start	End	E-Value	Type
low complexity region	36	47	N/A	INTRINSIC
WD40	49	91	1.79e-1	SMART
WD40	94	136	1.42e-4	SMART
WD40	139	178	5.31e-4	SMART
WD40	184	224	8.84e1	SMART
WD40	225	263	3.75e-4	SMART
WD40	313	353	4.69e-5	SMART
WD40	356	394	2.22e0	SMART
WD40	397	436	1.72e0	SMART
WD40	505	546	1.7e2	SMART
WD40	552	592	4.55e-3	SMART
low complexity region	613	625	N/A	INTRINSIC
Pfam:HELP	653	715	1.9e-22	PFAM
WD40	716	757	9.24e-1	SMART
WD40	760	802	6.53e-4	SMART
WD40	805	844	2.98e-1	SMART
WD40	856	891	8.52e1	SMART
WD40	892	929	2.09e-2	SMART
WD40	986	1026	1.18e-1	SMART
WD40	1032	1068	3.44e0	SMART
WD40	1071	1111	2.58e-1	SMART
WD40	1180	1221	9.24e-1	SMART
WD40	1227	1267	3.85e-1	SMART
low complexity region	1280	1291	N/A	INTRINSIC
Pfam:HELP	1329	1402	5e-15	PFAM
WD40	1404	1447	2.66e0	SMART
WD40	1450	1492	1.85e0	SMART
WD40	1495	1534	2.97e0	SMART
WD40	1543	1582	7.1e1	SMART
WD40	1584	1629	9.51e1	SMART
WD40	1675	1715	3.05e-4	SMART
WD40	1718	1758	8.84e1	SMART
WD40	1759	1798	7.16e-1	SMART
WD40	1869	1910	1.53e1	SMART
WD40	1916	1956	4.62e-4	SMART

Coding Region Coverage

1x: 93.3%
3x: 90.9%
10x: 85.6%
20x: 74.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	T	G	3: 122,105,316	I649S	probably damaging	Het
Abcc2	T	A	19: 43,803,782	L334*	probably null	Het
Adam28	A	T	14: 68,634,876	S306T	probably benign	Het
Adam34	T	A	8: 43,651,312	D432V	probably damaging	Het
Adcy7	A	G	8: 88,323,636	Y723C	probably benign	Het
Adgre5	T	A	8: 83,724,460	M713L	probably benign	Het
Aebp2	C	A	6: 140,637,686	C295*	probably null	Het
Amn1	G	T	6: 149,170,859	Q127K	probably benign	Het
Atcay	C	T	10: 81,210,549	V314M	probably damaging	Het
Atp1a1	T	C	3: 101,581,179	E847G	probably benign	Het
Atp2b1	A	G	10: 99,016,978	E1039G	probably benign	Het
Caskin1	A	G	17: 24,499,292	Y292C	probably damaging	Het
Cftr	A	G	6: 18,214,106	T94A	probably damaging	Het
Ciart	T	A	3: 95,880,476	K182M	probably damaging	Het
Col1a2	A	C	6: 4,527,079	S603R	possibly damaging	Het
Cspp1	C	A	1: 10,074,872	S298R	possibly damaging	Het
Cul7	T	A	17: 46,651,820	C126S	probably damaging	Het
Cyp2c55	A	T	19: 39,011,791	I145F	probably damaging	Het
Cypt4	G	C	9: 24,625,474	A87P	probably damaging	Het
Disp2	G	A	2: 118,787,644	V224M	probably benign	Het
Dlgap5	TTC	T	14: 47,401,522		probably null	Het
Dock1	A	G	7: 135,152,300	K1602R	probably benign	Het
Ears2	T	C	7: 122,048,339	I241V	probably benign	Het
Ephb2	T	C	4: 136,660,810	T660A	probably benign	Het
Fbxw7	G	A	3: 84,965,314	V268M		Het
Gart	A	G	16: 91,636,538	F289S	probably damaging	Het
Gmcl1	G	T	6: 86,704,538	N391K	probably benign	Het
Greb1l	A	C	18: 10,533,031	Q975P	probably damaging	Het
Greb1l	G	T	18: 10,533,032	Q975H	probably benign	Het
Grik5	C	A	7: 25,010,694	R872L	probably damaging	Het
Hmox2	T	A	16: 4,765,057	I218N	probably damaging	Het
Hook1	A	T	4: 96,014,852	D526V	probably damaging	Het
Ifna4	A	T	4: 88,841,954	N32Y	probably damaging	Het
Ighg2b	T	A	12: 113,306,872	N213Y	unknown	Het
Itih4	G	A	14: 30,901,170	V900I	probably benign	Het
Itpr2	A	T	6: 146,373,173	F837Y	probably damaging	Het
Kif3a	T	C	11: 53,579,114	V147A	probably benign	Het
Klra9	T	A	6: 130,191,321		probably benign	Het
Lamp3	G	T	16: 19,673,460	Q345K	probably benign	Het
Ltbp3	G	A	19: 5,757,794	E1188K	probably damaging	Het
Med1	T	A	11: 98,158,417	I518L	probably benign	Het
Mis18bp1	T	C	12: 65,158,673	T242A	probably damaging	Het
Nemp1	T	A	10: 127,696,254	F392Y	probably benign	Het
Obscn	C	A	11: 59,060,976	G3984W	probably damaging	Het
Obscn	T	A	11: 59,069,834	H3217L	possibly damaging	Het
Olfr1157	C	T	2: 87,962,458	V145M	possibly damaging	Het
Olfr1328	A	G	4: 118,934,626	M74T	probably benign	Het
Olfr1532-ps1	C	T	7: 106,914,929	H244Y	probably damaging	Het
Olfr709-ps1	T	C	7: 106,926,842	I206V	probably benign	Het
Olfr71	A	G	4: 43,706,464	Y35H	probably damaging	Het
P4ha1	G	T	10: 59,350,472	A258S	probably benign	Het
Parn	T	C	16: 13,607,281	I423V	probably benign	Het
Pcdh20	C	A	14: 88,467,308	S852I	probably damaging	Het
Pcnx3	A	G	19: 5,672,756		probably null	Het
Pcsk1	A	T	13: 75,112,650	I331F	probably damaging	Het
Pkd1l2	G	T	8: 117,022,022	S1803R	probably benign	Het
Pkd1l3	C	A	8: 109,660,801	N1792K	probably damaging	Het
Plekhg1	C	A	10: 3,963,469	Q1119K		Het
Prr30	T	A	14: 101,198,935	T64S	probably benign	Het
Rec114	T	C	9: 58,660,370	N111S	probably benign	Het
Reck	G	A	4: 43,895,850	V79I	probably benign	Het
Rexo1	A	G	10: 80,550,397	F276L	probably damaging	Het
Rgs6	T	C	12: 83,091,779	Y296H	probably damaging	Het
Sdk1	A	G	5: 142,212,038	R2149G	probably benign	Het
Slc20a2	C	A	8: 22,535,382	F33L	probably damaging	Het
Spopl	T	A	2: 23,545,449	T25S	probably damaging	Het
Srcap	A	T	7: 127,549,320	I1947F	possibly damaging	Het
Srek1	A	C	13: 103,744,783		probably null	Het
St8sia1	C	T	6: 142,829,252	W200*	probably null	Het
Tas2r106	A	T	6: 131,678,502	F129I	possibly damaging	Het
Tbrg4	A	T	11: 6,620,857	L205Q	probably damaging	Het
Tchh	C	A	3: 93,445,880	R876S	unknown	Het
Thap12	G	T	7: 98,715,038	A138S	probably benign	Het
Tjp1	C	T	7: 65,343,614		probably null	Het
Traf4	G	A	11: 78,161,534	P95L	probably benign	Het
Trappc9	ATCTC	ATCTCTC	15: 73,031,598		probably null	Het
Usp20	G	A	2: 31,017,486	V677M	possibly damaging	Het
Usp50	C	A	2: 126,783,316		probably benign	Het
Vmn1r21	T	C	6: 57,844,322	T46A	probably benign	Het
Vmn2r54	T	A	7: 12,629,742	H408L	probably benign	Het
Zfp266	T	C	9: 20,506,003	T30A	probably benign	Het
Zfp536	T	C	7: 37,479,757	H1141R	probably benign	Het

Other mutations in Eml6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01071:Eml6	APN	11	29850816	critical splice donor site	probably null
IGL01407:Eml6	APN	11	29755021	nonsense	probably null
IGL01434:Eml6	APN	11	29819090	missense	probably damaging	1.00
IGL01578:Eml6	APN	11	29850870	missense	probably benign	0.02
IGL01780:Eml6	APN	11	29805175	missense	probably benign	0.17
IGL01821:Eml6	APN	11	29821699	missense	probably benign	0.00
IGL01837:Eml6	APN	11	29777055	missense	probably benign	0.00
IGL01904:Eml6	APN	11	29838613	nonsense	probably null
IGL01972:Eml6	APN	11	29838451	missense	possibly damaging	0.67
IGL02134:Eml6	APN	11	29759066	missense	probably benign	0.13
IGL02192:Eml6	APN	11	29805743	missense	probably benign	0.00
IGL02377:Eml6	APN	11	29777282	missense	probably damaging	0.98
IGL02584:Eml6	APN	11	29749387	missense	probably damaging	0.99
IGL02587:Eml6	APN	11	29784236	missense	possibly damaging	0.92
IGL02810:Eml6	APN	11	29849016	missense	possibly damaging	0.94
IGL02873:Eml6	APN	11	29880700	missense	probably benign	0.10
IGL02880:Eml6	APN	11	29749959	missense	probably benign	0.03
IGL03289:Eml6	APN	11	29795328	missense	possibly damaging	0.49
IGL03301:Eml6	APN	11	29764083	missense	probably benign	0.18
IGL03386:Eml6	APN	11	29749934	missense	probably benign
IGL03407:Eml6	APN	11	29906330	missense	probably damaging	1.00
R0125:Eml6	UTSW	11	29882088	missense	probably benign	0.19
R0240:Eml6	UTSW	11	29792367	missense	possibly damaging	0.84
R0240:Eml6	UTSW	11	29792367	missense	possibly damaging	0.84
R0271:Eml6	UTSW	11	29848949	missense	possibly damaging	0.48
R0304:Eml6	UTSW	11	29777441	missense	probably benign	0.00
R0415:Eml6	UTSW	11	29749392	missense	possibly damaging	0.84
R0449:Eml6	UTSW	11	29893213	missense	probably benign	0.01
R0538:Eml6	UTSW	11	29760010	splice site	probably benign
R0671:Eml6	UTSW	11	29805065	missense	probably benign	0.00
R0766:Eml6	UTSW	11	29831219	splice site	probably benign
R0800:Eml6	UTSW	11	29749877	missense	probably benign	0.08
R0841:Eml6	UTSW	11	29777430	missense	probably benign	0.41
R0879:Eml6	UTSW	11	29850816	critical splice donor site	probably null
R1061:Eml6	UTSW	11	29777267	missense	probably damaging	1.00
R1145:Eml6	UTSW	11	29777430	missense	probably benign	0.41
R1145:Eml6	UTSW	11	29777430	missense	probably benign	0.41
R1172:Eml6	UTSW	11	29749824	missense	possibly damaging	0.54
R1173:Eml6	UTSW	11	29749824	missense	possibly damaging	0.54
R1174:Eml6	UTSW	11	29749824	missense	possibly damaging	0.54
R1199:Eml6	UTSW	11	29755044	missense	possibly damaging	0.93
R1311:Eml6	UTSW	11	29831088	splice site	probably benign
R1312:Eml6	UTSW	11	29831219	splice site	probably benign
R1355:Eml6	UTSW	11	29833085	missense	probably benign	0.03
R1370:Eml6	UTSW	11	29833085	missense	probably benign	0.03
R1457:Eml6	UTSW	11	30024459	missense	probably damaging	1.00
R1486:Eml6	UTSW	11	29805114	missense	possibly damaging	0.83
R1511:Eml6	UTSW	11	29818374	missense	probably damaging	1.00
R1532:Eml6	UTSW	11	29792256	splice site	probably null
R1642:Eml6	UTSW	11	29777001	critical splice donor site	probably null
R1682:Eml6	UTSW	11	29759065	missense	probably benign	0.13
R1687:Eml6	UTSW	11	29833187	missense	probably damaging	1.00
R1699:Eml6	UTSW	11	29746282	nonsense	probably null
R1796:Eml6	UTSW	11	29881975	missense	probably benign	0.19
R1797:Eml6	UTSW	11	29882041	missense	probably benign	0.09
R1837:Eml6	UTSW	11	29749802	splice site	probably null
R1874:Eml6	UTSW	11	29831136	missense	probably damaging	0.99
R1967:Eml6	UTSW	11	30024545	missense	probably damaging	1.00
R1969:Eml6	UTSW	11	29833075	missense	probably benign
R2007:Eml6	UTSW	11	29848814	critical splice donor site	probably null
R2012:Eml6	UTSW	11	29831128	missense	possibly damaging	0.85
R2198:Eml6	UTSW	11	29850935	missense	probably benign	0.01
R2217:Eml6	UTSW	11	29818907	missense	probably damaging	1.00
R2218:Eml6	UTSW	11	29818907	missense	probably damaging	1.00
R2403:Eml6	UTSW	11	29802434	missense	probably benign	0.05
R2520:Eml6	UTSW	11	29791993	missense	probably damaging	1.00
R2937:Eml6	UTSW	11	29833049	splice site	probably benign
R2938:Eml6	UTSW	11	29833049	splice site	probably benign
R3085:Eml6	UTSW	11	29809332	missense	probably damaging	0.96
R3236:Eml6	UTSW	11	29831097	critical splice donor site	probably null
R3738:Eml6	UTSW	11	29803137	missense	probably benign	0.20
R3739:Eml6	UTSW	11	29803137	missense	probably benign	0.20
R3752:Eml6	UTSW	11	29809360	missense	probably benign	0.06
R3854:Eml6	UTSW	11	29749905	missense	possibly damaging	0.76
R3941:Eml6	UTSW	11	29803167	missense	probably damaging	0.98
R4034:Eml6	UTSW	11	29803137	missense	probably benign	0.20
R4049:Eml6	UTSW	11	29838577	missense	probably damaging	1.00
R4108:Eml6	UTSW	11	29805136	missense	probably damaging	0.98
R4657:Eml6	UTSW	11	29805108	missense	possibly damaging	0.77
R4662:Eml6	UTSW	11	29777390	missense	probably damaging	1.00
R4665:Eml6	UTSW	11	29819007	nonsense	probably null
R4721:Eml6	UTSW	11	29838525	missense	possibly damaging	0.95
R4729:Eml6	UTSW	11	29833204	missense	probably damaging	1.00
R4766:Eml6	UTSW	11	29805757	missense	probably benign	0.22
R4810:Eml6	UTSW	11	29755011	missense	possibly damaging	0.92
R4831:Eml6	UTSW	11	29777052	nonsense	probably null
R5035:Eml6	UTSW	11	29854187	missense	probably benign	0.00
R5064:Eml6	UTSW	11	29749300	missense	probably benign	0.12
R5103:Eml6	UTSW	11	29850905	missense	possibly damaging	0.65
R5121:Eml6	UTSW	11	29744606	missense	probably benign	0.03
R5161:Eml6	UTSW	11	30024467	missense	probably damaging	0.99
R5211:Eml6	UTSW	11	29854145	missense	probably benign	0.02
R5268:Eml6	UTSW	11	29803108	missense	probably benign	0.15
R5390:Eml6	UTSW	11	29760096	missense	probably damaging	1.00
R5529:Eml6	UTSW	11	29764126	missense	probably benign	0.04
R6239:Eml6	UTSW	11	29749275	missense	probably damaging	1.00
R6326:Eml6	UTSW	11	29819066	missense	probably damaging	1.00
R6395:Eml6	UTSW	11	29809321	missense	probably benign	0.00
R6476:Eml6	UTSW	11	29791971	critical splice donor site	probably null
R6483:Eml6	UTSW	11	29749875	missense	probably benign	0.00
R6701:Eml6	UTSW	11	29785748	missense	probably damaging	0.98
R6753:Eml6	UTSW	11	29754987	missense	probably damaging	1.00
R6809:Eml6	UTSW	11	29803161	missense	probably benign	0.23
R6847:Eml6	UTSW	11	29818447	missense	probably benign	0.00
R6855:Eml6	UTSW	11	29751381	splice site	probably null
R7168:Eml6	UTSW	11	29838529	missense	probably benign	0.01
R7175:Eml6	UTSW	11	29784231	missense	probably benign	0.00
R7305:Eml6	UTSW	11	29777258	missense	probably benign	0.01
R7615:Eml6	UTSW	11	29802501	missense	possibly damaging	0.49
R7692:Eml6	UTSW	11	29753085	missense	probably damaging	0.98
R7980:Eml6	UTSW	11	29833205	missense	probably damaging	1.00
R8026:Eml6	UTSW	11	29749973	missense	possibly damaging	0.63
R8046:Eml6	UTSW	11	29758981	missense	probably damaging	0.99
R8049:Eml6	UTSW	11	29893201	missense	possibly damaging	0.95
R8114:Eml6	UTSW	11	29754910	missense	probably damaging	1.00
R8425:Eml6	UTSW	11	29755008	missense	probably benign	0.00
R8799:Eml6	UTSW	11	29758981	missense	probably benign	0.11
R8945:Eml6	UTSW	11	29753110	missense	probably damaging	0.98
R8977:Eml6	UTSW	11	29784182	missense	possibly damaging	0.59
R8986:Eml6	UTSW	11	29805181	missense	possibly damaging	0.92
R9088:Eml6	UTSW	11	29818424	missense	probably damaging	0.96
R9150:Eml6	UTSW	11	29805791	missense	probably benign	0.15
R9209:Eml6	UTSW	11	29831175	missense	probably damaging	1.00
R9288:Eml6	UTSW	11	29838641	critical splice acceptor site	probably null
R9467:Eml6	UTSW	11	29819076	missense	probably damaging	0.99
R9481:Eml6	UTSW	11	29838641	critical splice acceptor site	probably null
R9534:Eml6	UTSW	11	29784155	missense	possibly damaging	0.45
RF037:Eml6	UTSW	11	29752549	critical splice acceptor site	probably benign
RF039:Eml6	UTSW	11	29752551	critical splice acceptor site	probably benign

Predicted Primers

PCR Primer
(F):5'- AGCATCCCAGGAAGTTCTGTG -3'
(R):5'- CTGGCAGGTATATCAAGGATGATTTCC -3'

Sequencing Primer
(F):5'- GCATCCCAGGAAGTTCTGTGTAATC -3'
(R):5'- CTCCAGTGAGATTGGTGAACCTAC -3'

Posted On

2019-06-07