Incidental Mutation 'PIT4453001:Kif3a'
ID 555341
Institutional Source Beutler Lab
Gene Symbol Kif3a
Ensembl Gene ENSMUSG00000018395
Gene Name kinesin family member 3A
Synonyms kinesin-II subunit, N-4 kinesin, Kif3, Kifl, Kns3
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # PIT4453001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 53458206-53492794 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 53469941 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 147 (V147A)
Ref Sequence ENSEMBL: ENSMUSP00000056197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057330] [ENSMUST00000118353] [ENSMUST00000120613] [ENSMUST00000132496] [ENSMUST00000173744]
AlphaFold P28741
Predicted Effect probably benign
Transcript: ENSMUST00000057330
AA Change: V147A

PolyPhen 2 Score 0.157 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000056197
Gene: ENSMUSG00000018395
AA Change: V147A

DomainStartEndE-ValueType
KISc 12 353 9.79e-187 SMART
coiled coil region 416 593 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000118353
AA Change: V147A

PolyPhen 2 Score 0.642 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113848
Gene: ENSMUSG00000018395
AA Change: V147A

DomainStartEndE-ValueType
KISc 12 353 9.79e-187 SMART
low complexity region 365 418 N/A INTRINSIC
coiled coil region 443 620 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000120613
AA Change: V147A

PolyPhen 2 Score 0.644 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112782
Gene: ENSMUSG00000018395
AA Change: V147A

DomainStartEndE-ValueType
KISc 12 353 4.6e-189 SMART
coiled coil region 354 383 N/A INTRINSIC
coiled coil region 419 596 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000132496
AA Change: V146A

PolyPhen 2 Score 0.643 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000115161
Gene: ENSMUSG00000018395
AA Change: V146A

DomainStartEndE-ValueType
KISc 11 178 4.96e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132653
Predicted Effect possibly damaging
Transcript: ENSMUST00000173744
AA Change: V147A

PolyPhen 2 Score 0.644 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000133432
Gene: ENSMUSG00000018395
AA Change: V147A

DomainStartEndE-ValueType
KISc 12 353 9.79e-187 SMART
low complexity region 365 406 N/A INTRINSIC
low complexity region 462 473 N/A INTRINSIC
low complexity region 481 494 N/A INTRINSIC
low complexity region 498 526 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.9%
  • 10x: 85.6%
  • 20x: 74.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Nullizygous mutations result in embryonic lethality, failure to synthesize cilia in the embryonic node, randomization of left-right asymmetry and structural abnormalities of the neural tube, pericardium, branchial arches, and somites. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T G 3: 121,898,965 (GRCm39) I649S probably damaging Het
Abcc2 T A 19: 43,792,221 (GRCm39) L334* probably null Het
Adam28 A T 14: 68,872,325 (GRCm39) S306T probably benign Het
Adam34 T A 8: 44,104,349 (GRCm39) D432V probably damaging Het
Adcy7 A G 8: 89,050,264 (GRCm39) Y723C probably benign Het
Adgre5 T A 8: 84,451,089 (GRCm39) M713L probably benign Het
Aebp2 C A 6: 140,583,412 (GRCm39) C295* probably null Het
Amn1 G T 6: 149,072,357 (GRCm39) Q127K probably benign Het
Atcay C T 10: 81,046,383 (GRCm39) V314M probably damaging Het
Atp1a1 T C 3: 101,488,495 (GRCm39) E847G probably benign Het
Atp2b1 A G 10: 98,852,840 (GRCm39) E1039G probably benign Het
Caskin1 A G 17: 24,718,266 (GRCm39) Y292C probably damaging Het
Cftr A G 6: 18,214,105 (GRCm39) T94A probably damaging Het
Ciart T A 3: 95,787,788 (GRCm39) K182M probably damaging Het
Col1a2 A C 6: 4,527,079 (GRCm39) S603R possibly damaging Het
Cspp1 C A 1: 10,145,097 (GRCm39) S298R possibly damaging Het
Cul7 T A 17: 46,962,746 (GRCm39) C126S probably damaging Het
Cyp2c55 A T 19: 39,000,235 (GRCm39) I145F probably damaging Het
Cypt4 G C 9: 24,536,770 (GRCm39) A87P probably damaging Het
Disp2 G A 2: 118,618,125 (GRCm39) V224M probably benign Het
Dlgap5 TTC T 14: 47,638,979 (GRCm39) probably null Het
Dock1 A G 7: 134,754,029 (GRCm39) K1602R probably benign Het
Ears2 T C 7: 121,647,562 (GRCm39) I241V probably benign Het
Eml6 T C 11: 29,752,489 (GRCm39) T975A probably damaging Het
Ephb2 T C 4: 136,388,121 (GRCm39) T660A probably benign Het
Fbxw7 G A 3: 84,872,621 (GRCm39) V268M Het
Gart A G 16: 91,433,426 (GRCm39) F289S probably damaging Het
Gmcl1 G T 6: 86,681,520 (GRCm39) N391K probably benign Het
Greb1l A C 18: 10,533,031 (GRCm39) Q975P probably damaging Het
Greb1l G T 18: 10,533,032 (GRCm39) Q975H probably benign Het
Grik5 C A 7: 24,710,119 (GRCm39) R872L probably damaging Het
Hmox2 T A 16: 4,582,921 (GRCm39) I218N probably damaging Het
Hook1 A T 4: 95,903,089 (GRCm39) D526V probably damaging Het
Ifna4 A T 4: 88,760,191 (GRCm39) N32Y probably damaging Het
Ighg2b T A 12: 113,270,492 (GRCm39) N213Y unknown Het
Itih4 G A 14: 30,623,127 (GRCm39) V900I probably benign Het
Itpr2 A T 6: 146,274,671 (GRCm39) F837Y probably damaging Het
Klra9 T A 6: 130,168,284 (GRCm39) probably benign Het
Lamp3 G T 16: 19,492,210 (GRCm39) Q345K probably benign Het
Ltbp3 G A 19: 5,807,822 (GRCm39) E1188K probably damaging Het
Med1 T A 11: 98,049,243 (GRCm39) I518L probably benign Het
Mis18bp1 T C 12: 65,205,447 (GRCm39) T242A probably damaging Het
Nemp1 T A 10: 127,532,123 (GRCm39) F392Y probably benign Het
Obscn C A 11: 58,951,802 (GRCm39) G3984W probably damaging Het
Obscn T A 11: 58,960,660 (GRCm39) H3217L possibly damaging Het
Or10ak7 A G 4: 118,791,823 (GRCm39) M74T probably benign Het
Or13j1 A G 4: 43,706,464 (GRCm39) Y35H probably damaging Het
Or2d3b C T 7: 106,514,136 (GRCm39) H244Y probably damaging Het
Or2d3c T C 7: 106,526,049 (GRCm39) I206V probably benign Het
Or5l14 C T 2: 87,792,802 (GRCm39) V145M possibly damaging Het
P4ha1 G T 10: 59,186,294 (GRCm39) A258S probably benign Het
Parn T C 16: 13,425,145 (GRCm39) I423V probably benign Het
Pcdh20 C A 14: 88,704,744 (GRCm39) S852I probably damaging Het
Pcnx3 A G 19: 5,722,784 (GRCm39) probably null Het
Pcsk1 A T 13: 75,260,769 (GRCm39) I331F probably damaging Het
Pkd1l2 G T 8: 117,748,761 (GRCm39) S1803R probably benign Het
Pkd1l3 C A 8: 110,387,433 (GRCm39) N1792K probably damaging Het
Plekhg1 C A 10: 3,913,469 (GRCm39) Q1119K Het
Prr30 T A 14: 101,436,371 (GRCm39) T64S probably benign Het
Rec114 T C 9: 58,567,653 (GRCm39) N111S probably benign Het
Reck G A 4: 43,895,850 (GRCm39) V79I probably benign Het
Rexo1 A G 10: 80,386,231 (GRCm39) F276L probably damaging Het
Rgs6 T C 12: 83,138,553 (GRCm39) Y296H probably damaging Het
Sdk1 A G 5: 142,197,793 (GRCm39) R2149G probably benign Het
Slc20a2 C A 8: 23,025,398 (GRCm39) F33L probably damaging Het
Spopl T A 2: 23,435,461 (GRCm39) T25S probably damaging Het
Srcap A T 7: 127,148,492 (GRCm39) I1947F possibly damaging Het
Srek1 A C 13: 103,881,291 (GRCm39) probably null Het
St8sia1 C T 6: 142,774,978 (GRCm39) W200* probably null Het
Tas2r106 A T 6: 131,655,465 (GRCm39) F129I possibly damaging Het
Tbrg4 A T 11: 6,570,857 (GRCm39) L205Q probably damaging Het
Tchh C A 3: 93,353,187 (GRCm39) R876S unknown Het
Thap12 G T 7: 98,364,245 (GRCm39) A138S probably benign Het
Tjp1 C T 7: 64,993,362 (GRCm39) probably null Het
Traf4 G A 11: 78,052,360 (GRCm39) P95L probably benign Het
Trappc9 ATCTC ATCTCTC 15: 72,903,447 (GRCm39) probably null Het
Usp20 G A 2: 30,907,498 (GRCm39) V677M possibly damaging Het
Usp50 C A 2: 126,625,236 (GRCm39) probably benign Het
Vmn1r21 T C 6: 57,821,307 (GRCm39) T46A probably benign Het
Vmn2r54 T A 7: 12,363,669 (GRCm39) H408L probably benign Het
Zfp266 T C 9: 20,417,299 (GRCm39) T30A probably benign Het
Zfp536 T C 7: 37,179,182 (GRCm39) H1141R probably benign Het
Other mutations in Kif3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Kif3a APN 11 53,484,350 (GRCm39) missense possibly damaging 0.53
IGL01862:Kif3a APN 11 53,461,368 (GRCm39) missense possibly damaging 0.63
IGL02411:Kif3a APN 11 53,461,525 (GRCm39) missense probably damaging 1.00
R0049:Kif3a UTSW 11 53,481,560 (GRCm39) splice site probably benign
R0049:Kif3a UTSW 11 53,481,560 (GRCm39) splice site probably benign
R0078:Kif3a UTSW 11 53,469,812 (GRCm39) missense probably benign 0.22
R0131:Kif3a UTSW 11 53,477,743 (GRCm39) missense possibly damaging 0.53
R1079:Kif3a UTSW 11 53,461,408 (GRCm39) missense possibly damaging 0.87
R1168:Kif3a UTSW 11 53,489,139 (GRCm39) missense probably damaging 1.00
R1554:Kif3a UTSW 11 53,489,154 (GRCm39) missense probably damaging 0.98
R1817:Kif3a UTSW 11 53,489,561 (GRCm39) missense probably damaging 1.00
R2022:Kif3a UTSW 11 53,461,408 (GRCm39) missense probably damaging 1.00
R2964:Kif3a UTSW 11 53,469,757 (GRCm39) missense probably damaging 1.00
R3861:Kif3a UTSW 11 53,488,805 (GRCm39) missense probably benign 0.33
R3928:Kif3a UTSW 11 53,461,441 (GRCm39) missense probably benign 0.02
R4553:Kif3a UTSW 11 53,469,745 (GRCm39) missense possibly damaging 0.93
R5158:Kif3a UTSW 11 53,479,578 (GRCm39) missense probably benign
R5437:Kif3a UTSW 11 53,489,553 (GRCm39) missense probably damaging 0.99
R6621:Kif3a UTSW 11 53,469,957 (GRCm39) missense probably damaging 1.00
R7028:Kif3a UTSW 11 53,477,733 (GRCm39) nonsense probably null
R7384:Kif3a UTSW 11 53,469,681 (GRCm39) missense probably damaging 0.99
R8182:Kif3a UTSW 11 53,485,133 (GRCm39) nonsense probably null
R8493:Kif3a UTSW 11 53,489,627 (GRCm39) nonsense probably null
R8971:Kif3a UTSW 11 53,474,189 (GRCm39) missense probably damaging 1.00
R9261:Kif3a UTSW 11 53,484,248 (GRCm39) small deletion probably benign
R9577:Kif3a UTSW 11 53,475,231 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCACATATTTGGTCACATCGC -3'
(R):5'- AGTTCTAACCCGACTCAGCAG -3'

Sequencing Primer
(F):5'- TTTGGTCACATCGCAAAAGCAG -3'
(R):5'- TTATGCTCAAACGGGACTGC -3'
Posted On 2019-06-07