Incidental Mutation 'PIT4453001:Rgs6'
ID555347
Institutional Source Beutler Lab
Gene Symbol Rgs6
Ensembl Gene ENSMUSG00000021219
Gene Nameregulator of G-protein signaling 6
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #PIT4453001 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location82588292-83162056 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83091779 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 296 (Y296H)
Ref Sequence ENSEMBL: ENSMUSP00000125256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101234] [ENSMUST00000161801] [ENSMUST00000185665] [ENSMUST00000185674] [ENSMUST00000186081] [ENSMUST00000186309] [ENSMUST00000186323] [ENSMUST00000186458] [ENSMUST00000186848] [ENSMUST00000191107] [ENSMUST00000191311] [ENSMUST00000191352] [ENSMUST00000200911] [ENSMUST00000202210]
Predicted Effect probably damaging
Transcript: ENSMUST00000101234
AA Change: Y296H

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000098793
Gene: ENSMUSG00000021219
AA Change: Y296H

DomainStartEndE-ValueType
DEP 40 115 3.28e-24 SMART
G_gamma 255 319 2.23e-23 SMART
GGL 258 319 1.38e-27 SMART
RGS 336 451 2.05e-47 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000161801
AA Change: Y296H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125256
Gene: ENSMUSG00000021219
AA Change: Y296H

DomainStartEndE-ValueType
DEP 40 115 3.28e-24 SMART
G_gamma 255 319 2.23e-23 SMART
GGL 258 319 1.38e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185665
AA Change: Y296H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139566
Gene: ENSMUSG00000021219
AA Change: Y296H

DomainStartEndE-ValueType
DEP 40 115 1.5e-26 SMART
G_gamma 255 319 1e-27 SMART
GGL 258 319 8.7e-30 SMART
RGS 336 451 7.5e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185674
SMART Domains Protein: ENSMUSP00000139940
Gene: ENSMUSG00000021219

DomainStartEndE-ValueType
DEP 40 115 1.5e-26 SMART
RGS 299 414 7.5e-50 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000186081
AA Change: Y296H

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140188
Gene: ENSMUSG00000021219
AA Change: Y296H

DomainStartEndE-ValueType
DEP 40 115 1.5e-26 SMART
RGS 299 414 7.5e-50 SMART
low complexity region 417 425 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186309
AA Change: Y296H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140701
Gene: ENSMUSG00000021219
AA Change: Y296H

DomainStartEndE-ValueType
DEP 40 115 1.5e-26 SMART
G_gamma 255 319 1e-27 SMART
GGL 258 319 8.7e-30 SMART
RGS 336 451 7.5e-50 SMART
low complexity region 494 499 N/A INTRINSIC
low complexity region 511 523 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186323
SMART Domains Protein: ENSMUSP00000141079
Gene: ENSMUSG00000021219

DomainStartEndE-ValueType
DEP 40 115 1.5e-26 SMART
RGS 299 414 7.5e-50 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186458
AA Change: Y296H

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000139735
Gene: ENSMUSG00000021219
AA Change: Y296H

DomainStartEndE-ValueType
DEP 40 115 3.28e-24 SMART
G_gamma 255 319 2.23e-23 SMART
GGL 258 319 1.38e-27 SMART
RGS 336 451 2.05e-47 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186848
AA Change: Y261H

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000141044
Gene: ENSMUSG00000021219
AA Change: Y261H

DomainStartEndE-ValueType
DEP 5 80 1.6e-26 SMART
G_gamma 220 284 1.1e-27 SMART
GGL 223 284 8.8e-30 SMART
RGS 301 416 7.6e-50 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191107
AA Change: Y296H

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000139725
Gene: ENSMUSG00000021219
AA Change: Y296H

DomainStartEndE-ValueType
DEP 40 115 1.5e-26 SMART
G_gamma 255 319 1e-27 SMART
GGL 258 319 8.7e-30 SMART
RGS 336 451 7.5e-50 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191311
AA Change: Y296H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140723
Gene: ENSMUSG00000021219
AA Change: Y296H

DomainStartEndE-ValueType
DEP 40 115 1.5e-26 SMART
G_gamma 255 319 1e-27 SMART
GGL 258 319 8.7e-30 SMART
RGS 336 451 7.5e-50 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191352
AA Change: Y296H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139718
Gene: ENSMUSG00000021219
AA Change: Y296H

DomainStartEndE-ValueType
DEP 40 115 1.5e-26 SMART
G_gamma 255 319 1e-27 SMART
GGL 258 319 8.7e-30 SMART
RGS 336 451 7.5e-50 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000200911
AA Change: Y296H

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143801
Gene: ENSMUSG00000021219
AA Change: Y296H

DomainStartEndE-ValueType
DEP 40 115 3.28e-24 SMART
G_gamma 255 319 2.23e-23 SMART
GGL 258 319 1.38e-27 SMART
RGS 336 451 2.05e-47 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202210
AA Change: Y296H

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143961
Gene: ENSMUSG00000021219
AA Change: Y296H

DomainStartEndE-ValueType
DEP 40 115 3.28e-24 SMART
G_gamma 255 319 2.23e-23 SMART
GGL 258 319 1.38e-27 SMART
RGS 336 451 2.05e-47 SMART
Meta Mutation Damage Score 0.3001 question?
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.9%
  • 10x: 85.6%
  • 20x: 74.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the RGS (regulator of G protein signaling) family of proteins, which are defined by the presence of a RGS domain that confers the GTPase-activating activity of these proteins toward certain G alpha subunits. This protein also belongs to a subfamily of RGS proteins characterized by the presence of DEP (Dishevelled, Egl-10, and Pleckstrin) and GGL (G-protein gamma like)domains, the latter a G beta 5-interacting domain. The RGS proteins negatively regulate G protein signaling, and may modulate neuronal, cardiovascular, lymphocytic activities, and cancer risk. Mice lacking this gene exhibit decreased heart rate. Alternative splicing results in multiple transcript variants, however, the full-length nature of some of these variants is not known. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased heart rate and abnormal impulse conducting system conduction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T G 3: 122,105,316 I649S probably damaging Het
Abcc2 T A 19: 43,803,782 L334* probably null Het
Adam28 A T 14: 68,634,876 S306T probably benign Het
Adam34 T A 8: 43,651,312 D432V probably damaging Het
Adcy7 A G 8: 88,323,636 Y723C probably benign Het
Adgre5 T A 8: 83,724,460 M713L probably benign Het
Aebp2 C A 6: 140,637,686 C295* probably null Het
Amn1 G T 6: 149,170,859 Q127K probably benign Het
Atcay C T 10: 81,210,549 V314M probably damaging Het
Atp1a1 T C 3: 101,581,179 E847G probably benign Het
Atp2b1 A G 10: 99,016,978 E1039G probably benign Het
Caskin1 A G 17: 24,499,292 Y292C probably damaging Het
Cftr A G 6: 18,214,106 T94A probably damaging Het
Ciart T A 3: 95,880,476 K182M probably damaging Het
Col1a2 A C 6: 4,527,079 S603R possibly damaging Het
Cspp1 C A 1: 10,074,872 S298R possibly damaging Het
Cul7 T A 17: 46,651,820 C126S probably damaging Het
Cyp2c55 A T 19: 39,011,791 I145F probably damaging Het
Cypt4 G C 9: 24,625,474 A87P probably damaging Het
Disp2 G A 2: 118,787,644 V224M probably benign Het
Dlgap5 TTC T 14: 47,401,522 probably null Het
Dock1 A G 7: 135,152,300 K1602R probably benign Het
Ears2 T C 7: 122,048,339 I241V probably benign Het
Eml6 T C 11: 29,802,489 T975A probably damaging Het
Ephb2 T C 4: 136,660,810 T660A probably benign Het
Fbxw7 G A 3: 84,965,314 V268M Het
Gart A G 16: 91,636,538 F289S probably damaging Het
Gmcl1 G T 6: 86,704,538 N391K probably benign Het
Greb1l A C 18: 10,533,031 Q975P probably damaging Het
Greb1l G T 18: 10,533,032 Q975H probably benign Het
Grik5 C A 7: 25,010,694 R872L probably damaging Het
Hmox2 T A 16: 4,765,057 I218N probably damaging Het
Hook1 A T 4: 96,014,852 D526V probably damaging Het
Ifna4 A T 4: 88,841,954 N32Y probably damaging Het
Ighg2b T A 12: 113,306,872 N213Y unknown Het
Itih4 G A 14: 30,901,170 V900I probably benign Het
Itpr2 A T 6: 146,373,173 F837Y probably damaging Het
Kif3a T C 11: 53,579,114 V147A probably benign Het
Klra9 T A 6: 130,191,321 probably benign Het
Lamp3 G T 16: 19,673,460 Q345K probably benign Het
Ltbp3 G A 19: 5,757,794 E1188K probably damaging Het
Med1 T A 11: 98,158,417 I518L probably benign Het
Mis18bp1 T C 12: 65,158,673 T242A probably damaging Het
Nemp1 T A 10: 127,696,254 F392Y probably benign Het
Obscn C A 11: 59,060,976 G3984W probably damaging Het
Obscn T A 11: 59,069,834 H3217L possibly damaging Het
Olfr1157 C T 2: 87,962,458 V145M possibly damaging Het
Olfr1328 A G 4: 118,934,626 M74T probably benign Het
Olfr1532-ps1 C T 7: 106,914,929 H244Y probably damaging Het
Olfr709-ps1 T C 7: 106,926,842 I206V probably benign Het
Olfr71 A G 4: 43,706,464 Y35H probably damaging Het
P4ha1 G T 10: 59,350,472 A258S probably benign Het
Parn T C 16: 13,607,281 I423V probably benign Het
Pcdh20 C A 14: 88,467,308 S852I probably damaging Het
Pcnx3 A G 19: 5,672,756 probably null Het
Pcsk1 A T 13: 75,112,650 I331F probably damaging Het
Pkd1l2 G T 8: 117,022,022 S1803R probably benign Het
Pkd1l3 C A 8: 109,660,801 N1792K probably damaging Het
Plekhg1 C A 10: 3,963,469 Q1119K Het
Prr30 T A 14: 101,198,935 T64S probably benign Het
Rec114 T C 9: 58,660,370 N111S probably benign Het
Reck G A 4: 43,895,850 V79I probably benign Het
Rexo1 A G 10: 80,550,397 F276L probably damaging Het
Sdk1 A G 5: 142,212,038 R2149G probably benign Het
Slc20a2 C A 8: 22,535,382 F33L probably damaging Het
Spopl T A 2: 23,545,449 T25S probably damaging Het
Srcap A T 7: 127,549,320 I1947F possibly damaging Het
Srek1 A C 13: 103,744,783 probably null Het
St8sia1 C T 6: 142,829,252 W200* probably null Het
Tas2r106 A T 6: 131,678,502 F129I possibly damaging Het
Tbrg4 A T 11: 6,620,857 L205Q probably damaging Het
Tchh C A 3: 93,445,880 R876S unknown Het
Thap12 G T 7: 98,715,038 A138S probably benign Het
Tjp1 C T 7: 65,343,614 probably null Het
Traf4 G A 11: 78,161,534 P95L probably benign Het
Trappc9 ATCTC ATCTCTC 15: 73,031,598 probably null Het
Usp20 G A 2: 31,017,486 V677M possibly damaging Het
Usp50 C A 2: 126,783,316 probably benign Het
Vmn1r21 T C 6: 57,844,322 T46A probably benign Het
Vmn2r54 T A 7: 12,629,742 H408L probably benign Het
Zfp266 T C 9: 20,506,003 T30A probably benign Het
Zfp536 T C 7: 37,479,757 H1141R probably benign Het
Other mutations in Rgs6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Rgs6 APN 12 83051323 missense probably benign 0.01
IGL02131:Rgs6 APN 12 83069495 missense probably damaging 1.00
IGL02354:Rgs6 APN 12 82618619 intron probably benign
IGL02361:Rgs6 APN 12 82618619 intron probably benign
IGL02568:Rgs6 APN 12 83070602 missense probably benign 0.25
IGL02598:Rgs6 APN 12 83091797 missense probably benign 0.02
IGL03146:Rgs6 APN 12 83052538 missense probably damaging 1.00
IGL03248:Rgs6 APN 12 83052550 splice site probably benign
IGL03098:Rgs6 UTSW 12 82985376 missense probably damaging 1.00
IGL03147:Rgs6 UTSW 12 83091846 missense probably damaging 0.99
R0270:Rgs6 UTSW 12 83133689 missense probably damaging 1.00
R0390:Rgs6 UTSW 12 83133677 missense probably damaging 1.00
R0540:Rgs6 UTSW 12 83059804 nonsense probably null
R0630:Rgs6 UTSW 12 83047550 splice site probably benign
R1479:Rgs6 UTSW 12 83116244 missense probably damaging 1.00
R1533:Rgs6 UTSW 12 83091773 missense probably benign 0.00
R1545:Rgs6 UTSW 12 83116177 missense probably damaging 0.99
R2161:Rgs6 UTSW 12 83091804 missense probably damaging 1.00
R2421:Rgs6 UTSW 12 83116283 missense possibly damaging 0.93
R4089:Rgs6 UTSW 12 83063487 missense probably damaging 1.00
R4573:Rgs6 UTSW 12 83066015 missense probably damaging 1.00
R4821:Rgs6 UTSW 12 83067411 critical splice acceptor site probably null
R6228:Rgs6 UTSW 12 83065964 missense probably damaging 0.99
R7023:Rgs6 UTSW 12 83092104 intron probably benign
R7585:Rgs6 UTSW 12 83106870 missense probably damaging 1.00
R7610:Rgs6 UTSW 12 83091779 missense probably damaging 1.00
R7798:Rgs6 UTSW 12 83069519 missense probably benign 0.02
R8003:Rgs6 UTSW 12 82985370 missense probably damaging 0.99
R8011:Rgs6 UTSW 12 83116292 missense probably null 0.32
R8081:Rgs6 UTSW 12 83047573 nonsense probably null
R8248:Rgs6 UTSW 12 83137704 intron probably benign
R8267:Rgs6 UTSW 12 82651895 missense probably benign
R8285:Rgs6 UTSW 12 83116175 missense probably benign 0.14
RF008:Rgs6 UTSW 12 83063449 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCTGACATGTTGGGGACAG -3'
(R):5'- GAGGACACTTGGACCTCTTC -3'

Sequencing Primer
(F):5'- TTGGGGACAGGGCAGCTG -3'
(R):5'- GACACTTGGACCTCTTCTCCTCTAG -3'
Posted On2019-06-07