Incidental Mutation 'PIT4453001:Pcsk1'
ID555349
Institutional Source Beutler Lab
Gene Symbol Pcsk1
Ensembl Gene ENSMUSG00000021587
Gene Nameproprotein convertase subtilisin/kexin type 1
SynonymsPC3, PC1, Nec-1, SPC3, prohormone convertase 1/3, Nec1, Phpp-1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4453001 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location75089826-75134861 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 75112650 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 331 (I331F)
Ref Sequence ENSEMBL: ENSMUSP00000022075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022075]
PDB Structure
Solution Structure of the Mouse Prohormone Convertase 1 Pro-Domain [SOLUTION NMR]
PC1/3 DCSG sorting domain structure in DPC [SOLUTION NMR]
PC1/3 DCSG sorting domain in CHAPS [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000022075
AA Change: I331F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022075
Gene: ENSMUSG00000021587
AA Change: I331F

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:S8_pro-domain 34 110 6.4e-26 PFAM
Pfam:Peptidase_S8 158 442 2.2e-49 PFAM
Pfam:P_proprotein 504 591 6.1e-30 PFAM
low complexity region 679 694 N/A INTRINSIC
Pfam:Proho_convert 713 751 4.3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000222727
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.9%
  • 10x: 85.6%
  • 20x: 74.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an initial autocatalytic processing event in the ER to generate a heterodimer which exits the ER and sorts to subcellular compartments where a second autocatalytic even takes place and the catalytic activity is acquired. The protease is packaged into and activated in dense core secretory granules and expressed in the neuroendocrine system and brain. This gene encodes one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. It functions in the proteolytic activation of polypeptide hormones and neuropeptides precursors. Mutations in this gene have been associated with susceptibility to obesity and proprotein convertase 1/3 deficiency. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele show pre- and postnatal death, low weight, diarrhea, hypoglycemia, low insulin and GHRH levels, and lack mature glucagon and ACTH levels. Homozygotes for another null allele die prior to implantation. ENU mutants show obesity, polyphagia and higher metabolic efficiency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T G 3: 122,105,316 I649S probably damaging Het
Abcc2 T A 19: 43,803,782 L334* probably null Het
Adam28 A T 14: 68,634,876 S306T probably benign Het
Adam34 T A 8: 43,651,312 D432V probably damaging Het
Adcy7 A G 8: 88,323,636 Y723C probably benign Het
Adgre5 T A 8: 83,724,460 M713L probably benign Het
Aebp2 C A 6: 140,637,686 C295* probably null Het
Amn1 G T 6: 149,170,859 Q127K probably benign Het
Atcay C T 10: 81,210,549 V314M probably damaging Het
Atp1a1 T C 3: 101,581,179 E847G probably benign Het
Atp2b1 A G 10: 99,016,978 E1039G probably benign Het
Caskin1 A G 17: 24,499,292 Y292C probably damaging Het
Cftr A G 6: 18,214,106 T94A probably damaging Het
Ciart T A 3: 95,880,476 K182M probably damaging Het
Col1a2 A C 6: 4,527,079 S603R possibly damaging Het
Cspp1 C A 1: 10,074,872 S298R possibly damaging Het
Cul7 T A 17: 46,651,820 C126S probably damaging Het
Cyp2c55 A T 19: 39,011,791 I145F probably damaging Het
Cypt4 G C 9: 24,625,474 A87P probably damaging Het
Disp2 G A 2: 118,787,644 V224M probably benign Het
Dlgap5 TTC T 14: 47,401,522 probably null Het
Dock1 A G 7: 135,152,300 K1602R probably benign Het
Ears2 T C 7: 122,048,339 I241V probably benign Het
Eml6 T C 11: 29,802,489 T975A probably damaging Het
Ephb2 T C 4: 136,660,810 T660A probably benign Het
Fbxw7 G A 3: 84,965,314 V268M Het
Gart A G 16: 91,636,538 F289S probably damaging Het
Gmcl1 G T 6: 86,704,538 N391K probably benign Het
Greb1l A C 18: 10,533,031 Q975P probably damaging Het
Greb1l G T 18: 10,533,032 Q975H probably benign Het
Grik5 C A 7: 25,010,694 R872L probably damaging Het
Hmox2 T A 16: 4,765,057 I218N probably damaging Het
Hook1 A T 4: 96,014,852 D526V probably damaging Het
Ifna4 A T 4: 88,841,954 N32Y probably damaging Het
Ighg2b T A 12: 113,306,872 N213Y unknown Het
Itih4 G A 14: 30,901,170 V900I probably benign Het
Itpr2 A T 6: 146,373,173 F837Y probably damaging Het
Kif3a T C 11: 53,579,114 V147A probably benign Het
Klra9 T A 6: 130,191,321 probably benign Het
Lamp3 G T 16: 19,673,460 Q345K probably benign Het
Ltbp3 G A 19: 5,757,794 E1188K probably damaging Het
Med1 T A 11: 98,158,417 I518L probably benign Het
Mis18bp1 T C 12: 65,158,673 T242A probably damaging Het
Nemp1 T A 10: 127,696,254 F392Y probably benign Het
Obscn C A 11: 59,060,976 G3984W probably damaging Het
Obscn T A 11: 59,069,834 H3217L possibly damaging Het
Olfr1157 C T 2: 87,962,458 V145M possibly damaging Het
Olfr1328 A G 4: 118,934,626 M74T probably benign Het
Olfr1532-ps1 C T 7: 106,914,929 H244Y probably damaging Het
Olfr709-ps1 T C 7: 106,926,842 I206V probably benign Het
Olfr71 A G 4: 43,706,464 Y35H probably damaging Het
P4ha1 G T 10: 59,350,472 A258S probably benign Het
Parn T C 16: 13,607,281 I423V probably benign Het
Pcdh20 C A 14: 88,467,308 S852I probably damaging Het
Pcnx3 A G 19: 5,672,756 probably null Het
Pkd1l2 G T 8: 117,022,022 S1803R probably benign Het
Pkd1l3 C A 8: 109,660,801 N1792K probably damaging Het
Plekhg1 C A 10: 3,963,469 Q1119K Het
Prr30 T A 14: 101,198,935 T64S probably benign Het
Rec114 T C 9: 58,660,370 N111S probably benign Het
Reck G A 4: 43,895,850 V79I probably benign Het
Rexo1 A G 10: 80,550,397 F276L probably damaging Het
Rgs6 T C 12: 83,091,779 Y296H probably damaging Het
Sdk1 A G 5: 142,212,038 R2149G probably benign Het
Slc20a2 C A 8: 22,535,382 F33L probably damaging Het
Spopl T A 2: 23,545,449 T25S probably damaging Het
Srcap A T 7: 127,549,320 I1947F possibly damaging Het
Srek1 A C 13: 103,744,783 probably null Het
St8sia1 C T 6: 142,829,252 W200* probably null Het
Tas2r106 A T 6: 131,678,502 F129I possibly damaging Het
Tbrg4 A T 11: 6,620,857 L205Q probably damaging Het
Tchh C A 3: 93,445,880 R876S unknown Het
Thap12 G T 7: 98,715,038 A138S probably benign Het
Tjp1 C T 7: 65,343,614 probably null Het
Traf4 G A 11: 78,161,534 P95L probably benign Het
Trappc9 ATCTC ATCTCTC 15: 73,031,598 probably null Het
Usp20 G A 2: 31,017,486 V677M possibly damaging Het
Usp50 C A 2: 126,783,316 probably benign Het
Vmn1r21 T C 6: 57,844,322 T46A probably benign Het
Vmn2r54 T A 7: 12,629,742 H408L probably benign Het
Zfp266 T C 9: 20,506,003 T30A probably benign Het
Zfp536 T C 7: 37,479,757 H1141R probably benign Het
Other mutations in Pcsk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Pcsk1 APN 13 75132087 missense probably benign
IGL01554:Pcsk1 APN 13 75132307 missense probably benign
IGL01960:Pcsk1 APN 13 75093167 missense possibly damaging 0.82
IGL02026:Pcsk1 APN 13 75112653 missense probably benign 0.16
IGL02047:Pcsk1 APN 13 75097989 missense probably benign 0.33
IGL02264:Pcsk1 APN 13 75105959 missense probably damaging 1.00
IGL02441:Pcsk1 APN 13 75132163 missense probably benign 0.16
IGL02795:Pcsk1 APN 13 75112620 missense probably damaging 1.00
IGL02829:Pcsk1 APN 13 75126836 missense probably damaging 1.00
IGL03116:Pcsk1 APN 13 75132216 missense probably damaging 0.99
IGL03156:Pcsk1 APN 13 75131951 missense probably benign
clipper UTSW 13 75130070 missense probably damaging 1.00
spareribs UTSW 13 75115255 missense possibly damaging 0.88
swivel UTSW 13 75125984 missense probably damaging 1.00
Tweeze UTSW 13 75126839 missense probably benign 0.00
R0771:Pcsk1 UTSW 13 75132162 missense probably benign 0.31
R0894:Pcsk1 UTSW 13 75097977 missense probably damaging 1.00
R1014:Pcsk1 UTSW 13 75132234 missense probably damaging 1.00
R1035:Pcsk1 UTSW 13 75132119 missense probably benign
R1199:Pcsk1 UTSW 13 75096413 splice site probably benign
R1517:Pcsk1 UTSW 13 75098047 nonsense probably null
R1625:Pcsk1 UTSW 13 75126852 missense probably benign 0.11
R1691:Pcsk1 UTSW 13 75132225 missense possibly damaging 0.65
R1717:Pcsk1 UTSW 13 75110828 missense probably damaging 0.99
R2168:Pcsk1 UTSW 13 75112534 intron probably benign
R2252:Pcsk1 UTSW 13 75126726 missense probably benign 0.00
R2400:Pcsk1 UTSW 13 75090126 missense probably benign 0.00
R4110:Pcsk1 UTSW 13 75096369 missense probably damaging 0.99
R4358:Pcsk1 UTSW 13 75112719 missense possibly damaging 0.58
R4359:Pcsk1 UTSW 13 75112719 missense possibly damaging 0.58
R4657:Pcsk1 UTSW 13 75132235 missense probably damaging 1.00
R5195:Pcsk1 UTSW 13 75126855 missense probably damaging 1.00
R5669:Pcsk1 UTSW 13 75130102 missense probably benign 0.01
R5671:Pcsk1 UTSW 13 75097907 missense possibly damaging 0.63
R5745:Pcsk1 UTSW 13 75131960 missense probably benign 0.03
R6107:Pcsk1 UTSW 13 75127848 missense probably benign 0.09
R6200:Pcsk1 UTSW 13 75115255 missense possibly damaging 0.88
R6326:Pcsk1 UTSW 13 75132179 missense possibly damaging 0.89
R6537:Pcsk1 UTSW 13 75132239 missense probably damaging 1.00
R6541:Pcsk1 UTSW 13 75125984 missense probably damaging 1.00
R6567:Pcsk1 UTSW 13 75130070 missense probably damaging 1.00
R6723:Pcsk1 UTSW 13 75093069 splice site probably null
R7258:Pcsk1 UTSW 13 75093186 missense probably damaging 1.00
R7357:Pcsk1 UTSW 13 75125960 missense probably damaging 0.96
R7487:Pcsk1 UTSW 13 75110883 missense probably benign 0.01
R7519:Pcsk1 UTSW 13 75110865 missense probably damaging 0.99
R7647:Pcsk1 UTSW 13 75132210 missense possibly damaging 0.73
R7787:Pcsk1 UTSW 13 75132158 missense possibly damaging 0.88
R7944:Pcsk1 UTSW 13 75132092 missense probably benign
R7945:Pcsk1 UTSW 13 75132092 missense probably benign
R7961:Pcsk1 UTSW 13 75126839 missense probably benign 0.00
R8009:Pcsk1 UTSW 13 75126839 missense probably benign 0.00
R8022:Pcsk1 UTSW 13 75099293 missense possibly damaging 0.77
R8171:Pcsk1 UTSW 13 75090091 nonsense probably null
Z1176:Pcsk1 UTSW 13 75098042 missense probably damaging 1.00
Z1177:Pcsk1 UTSW 13 75125864 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGAGCTTGCTGGTAACC -3'
(R):5'- CCCAATTGATACGTCAAGCG -3'

Sequencing Primer
(F):5'- GAGCTTGCTGGTAACCACAATTG -3'
(R):5'- TTTCCCACAAAGGTCAGGG -3'
Posted On2019-06-07