Incidental Mutation 'PIT4453001:Pcdh20'
ID 555354
Institutional Source Beutler Lab
Gene Symbol Pcdh20
Ensembl Gene ENSMUSG00000050505
Gene Name protocadherin 20
Synonyms PCDH13, C630015B17Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # PIT4453001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 88702183-88708832 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 88704744 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Isoleucine at position 852 (S852I)
Ref Sequence ENSEMBL: ENSMUSP00000054774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061628] [ENSMUST00000192557]
AlphaFold Q8BIZ0
Predicted Effect probably damaging
Transcript: ENSMUST00000061628
AA Change: S852I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054774
Gene: ENSMUSG00000050505
AA Change: S852I

DomainStartEndE-ValueType
CA 108 208 9.02e-1 SMART
CA 233 319 6.63e-16 SMART
CA 343 425 9.94e-2 SMART
CA 455 534 7.48e-3 SMART
CA 558 638 5.46e-26 SMART
CA 662 741 7.2e-26 SMART
CA 768 852 9.6e-13 SMART
low complexity region 860 871 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192557
AA Change: S852I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141860
Gene: ENSMUSG00000050505
AA Change: S852I

DomainStartEndE-ValueType
CA 108 208 9.02e-1 SMART
CA 233 319 6.63e-16 SMART
CA 343 425 9.94e-2 SMART
CA 455 534 7.48e-3 SMART
CA 558 638 5.46e-26 SMART
CA 662 741 7.2e-26 SMART
CA 768 852 9.6e-13 SMART
low complexity region 860 871 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.9%
  • 10x: 85.6%
  • 20x: 74.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The encoded protein contains six extracellular cadherin domains, a transmembrane domain, and a cytoplasmic tail differing from those of the classical cadherins. The encoded protein may play a role in cell adhesion in the nervous system and has been shown to be specifically expressed in newly differentiated olfactory sensory neurons and their axons during development. In adult mice, the expression of this protein in the olfactory system is more restricted but shows a gender difference with higher expression in the male than in the female. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T G 3: 121,898,965 (GRCm39) I649S probably damaging Het
Abcc2 T A 19: 43,792,221 (GRCm39) L334* probably null Het
Adam28 A T 14: 68,872,325 (GRCm39) S306T probably benign Het
Adam34 T A 8: 44,104,349 (GRCm39) D432V probably damaging Het
Adcy7 A G 8: 89,050,264 (GRCm39) Y723C probably benign Het
Adgre5 T A 8: 84,451,089 (GRCm39) M713L probably benign Het
Aebp2 C A 6: 140,583,412 (GRCm39) C295* probably null Het
Amn1 G T 6: 149,072,357 (GRCm39) Q127K probably benign Het
Atcay C T 10: 81,046,383 (GRCm39) V314M probably damaging Het
Atp1a1 T C 3: 101,488,495 (GRCm39) E847G probably benign Het
Atp2b1 A G 10: 98,852,840 (GRCm39) E1039G probably benign Het
Caskin1 A G 17: 24,718,266 (GRCm39) Y292C probably damaging Het
Cftr A G 6: 18,214,105 (GRCm39) T94A probably damaging Het
Ciart T A 3: 95,787,788 (GRCm39) K182M probably damaging Het
Col1a2 A C 6: 4,527,079 (GRCm39) S603R possibly damaging Het
Cspp1 C A 1: 10,145,097 (GRCm39) S298R possibly damaging Het
Cul7 T A 17: 46,962,746 (GRCm39) C126S probably damaging Het
Cyp2c55 A T 19: 39,000,235 (GRCm39) I145F probably damaging Het
Cypt4 G C 9: 24,536,770 (GRCm39) A87P probably damaging Het
Disp2 G A 2: 118,618,125 (GRCm39) V224M probably benign Het
Dlgap5 TTC T 14: 47,638,979 (GRCm39) probably null Het
Dock1 A G 7: 134,754,029 (GRCm39) K1602R probably benign Het
Ears2 T C 7: 121,647,562 (GRCm39) I241V probably benign Het
Eml6 T C 11: 29,752,489 (GRCm39) T975A probably damaging Het
Ephb2 T C 4: 136,388,121 (GRCm39) T660A probably benign Het
Fbxw7 G A 3: 84,872,621 (GRCm39) V268M Het
Gart A G 16: 91,433,426 (GRCm39) F289S probably damaging Het
Gmcl1 G T 6: 86,681,520 (GRCm39) N391K probably benign Het
Greb1l A C 18: 10,533,031 (GRCm39) Q975P probably damaging Het
Greb1l G T 18: 10,533,032 (GRCm39) Q975H probably benign Het
Grik5 C A 7: 24,710,119 (GRCm39) R872L probably damaging Het
Hmox2 T A 16: 4,582,921 (GRCm39) I218N probably damaging Het
Hook1 A T 4: 95,903,089 (GRCm39) D526V probably damaging Het
Ifna4 A T 4: 88,760,191 (GRCm39) N32Y probably damaging Het
Ighg2b T A 12: 113,270,492 (GRCm39) N213Y unknown Het
Itih4 G A 14: 30,623,127 (GRCm39) V900I probably benign Het
Itpr2 A T 6: 146,274,671 (GRCm39) F837Y probably damaging Het
Kif3a T C 11: 53,469,941 (GRCm39) V147A probably benign Het
Klra9 T A 6: 130,168,284 (GRCm39) probably benign Het
Lamp3 G T 16: 19,492,210 (GRCm39) Q345K probably benign Het
Ltbp3 G A 19: 5,807,822 (GRCm39) E1188K probably damaging Het
Med1 T A 11: 98,049,243 (GRCm39) I518L probably benign Het
Mis18bp1 T C 12: 65,205,447 (GRCm39) T242A probably damaging Het
Nemp1 T A 10: 127,532,123 (GRCm39) F392Y probably benign Het
Obscn C A 11: 58,951,802 (GRCm39) G3984W probably damaging Het
Obscn T A 11: 58,960,660 (GRCm39) H3217L possibly damaging Het
Or10ak7 A G 4: 118,791,823 (GRCm39) M74T probably benign Het
Or13j1 A G 4: 43,706,464 (GRCm39) Y35H probably damaging Het
Or2d3b C T 7: 106,514,136 (GRCm39) H244Y probably damaging Het
Or2d3c T C 7: 106,526,049 (GRCm39) I206V probably benign Het
Or5l14 C T 2: 87,792,802 (GRCm39) V145M possibly damaging Het
P4ha1 G T 10: 59,186,294 (GRCm39) A258S probably benign Het
Parn T C 16: 13,425,145 (GRCm39) I423V probably benign Het
Pcnx3 A G 19: 5,722,784 (GRCm39) probably null Het
Pcsk1 A T 13: 75,260,769 (GRCm39) I331F probably damaging Het
Pkd1l2 G T 8: 117,748,761 (GRCm39) S1803R probably benign Het
Pkd1l3 C A 8: 110,387,433 (GRCm39) N1792K probably damaging Het
Plekhg1 C A 10: 3,913,469 (GRCm39) Q1119K Het
Prr30 T A 14: 101,436,371 (GRCm39) T64S probably benign Het
Rec114 T C 9: 58,567,653 (GRCm39) N111S probably benign Het
Reck G A 4: 43,895,850 (GRCm39) V79I probably benign Het
Rexo1 A G 10: 80,386,231 (GRCm39) F276L probably damaging Het
Rgs6 T C 12: 83,138,553 (GRCm39) Y296H probably damaging Het
Sdk1 A G 5: 142,197,793 (GRCm39) R2149G probably benign Het
Slc20a2 C A 8: 23,025,398 (GRCm39) F33L probably damaging Het
Spopl T A 2: 23,435,461 (GRCm39) T25S probably damaging Het
Srcap A T 7: 127,148,492 (GRCm39) I1947F possibly damaging Het
Srek1 A C 13: 103,881,291 (GRCm39) probably null Het
St8sia1 C T 6: 142,774,978 (GRCm39) W200* probably null Het
Tas2r106 A T 6: 131,655,465 (GRCm39) F129I possibly damaging Het
Tbrg4 A T 11: 6,570,857 (GRCm39) L205Q probably damaging Het
Tchh C A 3: 93,353,187 (GRCm39) R876S unknown Het
Thap12 G T 7: 98,364,245 (GRCm39) A138S probably benign Het
Tjp1 C T 7: 64,993,362 (GRCm39) probably null Het
Traf4 G A 11: 78,052,360 (GRCm39) P95L probably benign Het
Trappc9 ATCTC ATCTCTC 15: 72,903,447 (GRCm39) probably null Het
Usp20 G A 2: 30,907,498 (GRCm39) V677M possibly damaging Het
Usp50 C A 2: 126,625,236 (GRCm39) probably benign Het
Vmn1r21 T C 6: 57,821,307 (GRCm39) T46A probably benign Het
Vmn2r54 T A 7: 12,363,669 (GRCm39) H408L probably benign Het
Zfp266 T C 9: 20,417,299 (GRCm39) T30A probably benign Het
Zfp536 T C 7: 37,179,182 (GRCm39) H1141R probably benign Het
Other mutations in Pcdh20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Pcdh20 APN 14 88,705,317 (GRCm39) missense possibly damaging 0.65
IGL01112:Pcdh20 APN 14 88,704,636 (GRCm39) missense probably benign 0.01
IGL01586:Pcdh20 APN 14 88,708,344 (GRCm39) missense probably benign 0.37
IGL02007:Pcdh20 APN 14 88,707,031 (GRCm39) missense probably benign 0.09
IGL02545:Pcdh20 APN 14 88,706,280 (GRCm39) missense possibly damaging 0.74
IGL02935:Pcdh20 APN 14 88,704,438 (GRCm39) utr 3 prime probably benign
PIT4362001:Pcdh20 UTSW 14 88,704,462 (GRCm39) missense probably damaging 0.97
PIT4403001:Pcdh20 UTSW 14 88,704,462 (GRCm39) missense probably damaging 0.97
R0322:Pcdh20 UTSW 14 88,706,383 (GRCm39) missense probably benign 0.24
R0372:Pcdh20 UTSW 14 88,706,439 (GRCm39) missense probably damaging 1.00
R0391:Pcdh20 UTSW 14 88,706,104 (GRCm39) missense probably benign
R0575:Pcdh20 UTSW 14 88,705,048 (GRCm39) missense probably damaging 1.00
R0789:Pcdh20 UTSW 14 88,706,226 (GRCm39) missense probably damaging 1.00
R1370:Pcdh20 UTSW 14 88,705,737 (GRCm39) missense probably benign 0.00
R1465:Pcdh20 UTSW 14 88,706,673 (GRCm39) missense probably benign 0.00
R1465:Pcdh20 UTSW 14 88,706,673 (GRCm39) missense probably benign 0.00
R1664:Pcdh20 UTSW 14 88,705,758 (GRCm39) missense possibly damaging 0.63
R1677:Pcdh20 UTSW 14 88,705,410 (GRCm39) missense probably damaging 1.00
R1764:Pcdh20 UTSW 14 88,706,620 (GRCm39) missense possibly damaging 0.77
R1907:Pcdh20 UTSW 14 88,706,140 (GRCm39) missense probably benign 0.01
R2043:Pcdh20 UTSW 14 88,704,591 (GRCm39) missense probably benign 0.01
R2430:Pcdh20 UTSW 14 88,704,984 (GRCm39) missense probably damaging 1.00
R2471:Pcdh20 UTSW 14 88,704,672 (GRCm39) missense probably benign 0.00
R3838:Pcdh20 UTSW 14 88,705,899 (GRCm39) missense probably benign 0.00
R4163:Pcdh20 UTSW 14 88,705,615 (GRCm39) missense probably damaging 1.00
R4472:Pcdh20 UTSW 14 88,706,434 (GRCm39) missense probably benign 0.21
R4602:Pcdh20 UTSW 14 88,705,866 (GRCm39) missense probably damaging 1.00
R4681:Pcdh20 UTSW 14 88,705,052 (GRCm39) missense probably damaging 1.00
R4918:Pcdh20 UTSW 14 88,705,104 (GRCm39) missense probably damaging 1.00
R4921:Pcdh20 UTSW 14 88,707,162 (GRCm39) missense probably benign 0.01
R5204:Pcdh20 UTSW 14 88,706,351 (GRCm39) missense probably damaging 1.00
R5256:Pcdh20 UTSW 14 88,705,813 (GRCm39) missense probably benign
R5652:Pcdh20 UTSW 14 88,704,760 (GRCm39) missense probably damaging 1.00
R5815:Pcdh20 UTSW 14 88,708,312 (GRCm39) missense probably benign 0.03
R6195:Pcdh20 UTSW 14 88,705,488 (GRCm39) missense probably benign 0.39
R6233:Pcdh20 UTSW 14 88,705,488 (GRCm39) missense probably benign 0.39
R6848:Pcdh20 UTSW 14 88,704,690 (GRCm39) missense probably benign 0.03
R6913:Pcdh20 UTSW 14 88,706,038 (GRCm39) missense probably benign
R7044:Pcdh20 UTSW 14 88,706,607 (GRCm39) missense probably damaging 0.98
R7224:Pcdh20 UTSW 14 88,706,511 (GRCm39) missense possibly damaging 0.85
R7388:Pcdh20 UTSW 14 88,706,103 (GRCm39) missense probably benign 0.33
R7486:Pcdh20 UTSW 14 88,706,050 (GRCm39) missense possibly damaging 0.79
R7651:Pcdh20 UTSW 14 88,706,589 (GRCm39) missense probably damaging 1.00
R7664:Pcdh20 UTSW 14 88,706,803 (GRCm39) missense probably benign
R7706:Pcdh20 UTSW 14 88,704,793 (GRCm39) missense probably damaging 1.00
R7832:Pcdh20 UTSW 14 88,707,143 (GRCm39) missense probably null 0.02
R7892:Pcdh20 UTSW 14 88,704,867 (GRCm39) nonsense probably null
R8218:Pcdh20 UTSW 14 88,706,047 (GRCm39) missense probably damaging 0.96
R8545:Pcdh20 UTSW 14 88,706,601 (GRCm39) missense probably damaging 0.96
R8701:Pcdh20 UTSW 14 88,705,849 (GRCm39) missense possibly damaging 0.95
R9219:Pcdh20 UTSW 14 88,706,255 (GRCm39) missense probably benign 0.01
R9238:Pcdh20 UTSW 14 88,706,190 (GRCm39) missense probably benign 0.43
R9418:Pcdh20 UTSW 14 88,705,455 (GRCm39) missense probably benign
R9665:Pcdh20 UTSW 14 88,707,162 (GRCm39) missense probably benign 0.44
X0028:Pcdh20 UTSW 14 88,705,053 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATCCCTGTAACTAGTGTGATGG -3'
(R):5'- TATGCGGTTGACAAAGACACAG -3'

Sequencing Primer
(F):5'- CCTGTAACTAGTGTGATGGAGCCC -3'
(R):5'- GGTCCCAGGCCTGAGTCTTTC -3'
Posted On 2019-06-07