Incidental Mutation 'PIT4453001:Hmox2'
ID555357
Institutional Source Beutler Lab
Gene Symbol Hmox2
Ensembl Gene ENSMUSG00000004070
Gene Nameheme oxygenase 2
SynonymsHO2, HO-2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4453001 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location4726361-4766742 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4765057 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 218 (I218N)
Ref Sequence ENSEMBL: ENSMUSP00000004172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004172] [ENSMUST00000004173] [ENSMUST00000117713] [ENSMUST00000118703] [ENSMUST00000118885] [ENSMUST00000120232] [ENSMUST00000121529] [ENSMUST00000140367] [ENSMUST00000147225] [ENSMUST00000154117]
Predicted Effect probably damaging
Transcript: ENSMUST00000004172
AA Change: I218N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000004172
Gene: ENSMUSG00000004070
AA Change: I218N

DomainStartEndE-ValueType
Pfam:Heme_oxygenase 30 235 2e-83 PFAM
transmembrane domain 295 314 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000004173
SMART Domains Protein: ENSMUSP00000004173
Gene: ENSMUSG00000004071

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
low complexity region 51 69 N/A INTRINSIC
low complexity region 77 110 N/A INTRINSIC
LITAF 137 206 4.1e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117713
SMART Domains Protein: ENSMUSP00000113618
Gene: ENSMUSG00000004071

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
low complexity region 51 69 N/A INTRINSIC
low complexity region 81 93 N/A INTRINSIC
LITAF 120 189 4.1e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118703
SMART Domains Protein: ENSMUSP00000113889
Gene: ENSMUSG00000004071

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
low complexity region 51 69 N/A INTRINSIC
low complexity region 77 110 N/A INTRINSIC
LITAF 137 206 4.1e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118885
AA Change: I218N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113110
Gene: ENSMUSG00000004070
AA Change: I218N

DomainStartEndE-ValueType
Pfam:Heme_oxygenase 30 235 2e-83 PFAM
transmembrane domain 295 314 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120232
AA Change: I218N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112397
Gene: ENSMUSG00000004070
AA Change: I218N

DomainStartEndE-ValueType
Pfam:Heme_oxygenase 30 235 2e-83 PFAM
transmembrane domain 295 314 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121529
AA Change: I218N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112378
Gene: ENSMUSG00000004070
AA Change: I218N

DomainStartEndE-ValueType
Pfam:Heme_oxygenase 30 228 6.8e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140367
SMART Domains Protein: ENSMUSP00000115932
Gene: ENSMUSG00000004070

DomainStartEndE-ValueType
Pfam:Heme_oxygenase 30 93 1.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147225
SMART Domains Protein: ENSMUSP00000120143
Gene: ENSMUSG00000004071

DomainStartEndE-ValueType
low complexity region 41 59 N/A INTRINSIC
low complexity region 67 100 N/A INTRINSIC
Pfam:zf-LITAF-like 123 163 3.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154117
SMART Domains Protein: ENSMUSP00000122699
Gene: ENSMUSG00000004070

DomainStartEndE-ValueType
Pfam:Heme_oxygenase 1 65 1.9e-22 PFAM
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.9%
  • 10x: 85.6%
  • 20x: 74.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heme oxygenase, an essential enzyme in heme catabolism, cleaves heme to form biliverdin, which is subsequently converted to bilirubin by biliverdin reductase, and carbon monoxide, a putative neurotransmitter. Heme oxygenase activity is induced by its substrate heme and by various nonheme substances. Heme oxygenase occurs as 2 isozymes, an inducible heme oxygenase-1 and a constitutive heme oxygenase-2. HMOX1 and HMOX2 belong to the heme oxygenase family. Several alternatively spliced transcript variants encoding three different isoforms have been found for this gene. [provided by RefSeq, Oct 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene are normal for the most part. However, they are sensitive to incrreases and decreases in oxygen levels and this results in some behavioral and nervous system response abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T G 3: 122,105,316 I649S probably damaging Het
Abcc2 T A 19: 43,803,782 L334* probably null Het
Adam28 A T 14: 68,634,876 S306T probably benign Het
Adam34 T A 8: 43,651,312 D432V probably damaging Het
Adcy7 A G 8: 88,323,636 Y723C probably benign Het
Adgre5 T A 8: 83,724,460 M713L probably benign Het
Aebp2 C A 6: 140,637,686 C295* probably null Het
Amn1 G T 6: 149,170,859 Q127K probably benign Het
Atcay C T 10: 81,210,549 V314M probably damaging Het
Atp1a1 T C 3: 101,581,179 E847G probably benign Het
Atp2b1 A G 10: 99,016,978 E1039G probably benign Het
Caskin1 A G 17: 24,499,292 Y292C probably damaging Het
Cftr A G 6: 18,214,106 T94A probably damaging Het
Ciart T A 3: 95,880,476 K182M probably damaging Het
Col1a2 A C 6: 4,527,079 S603R possibly damaging Het
Cspp1 C A 1: 10,074,872 S298R possibly damaging Het
Cul7 T A 17: 46,651,820 C126S probably damaging Het
Cyp2c55 A T 19: 39,011,791 I145F probably damaging Het
Cypt4 G C 9: 24,625,474 A87P probably damaging Het
Disp2 G A 2: 118,787,644 V224M probably benign Het
Dlgap5 TTC T 14: 47,401,522 probably null Het
Dock1 A G 7: 135,152,300 K1602R probably benign Het
Ears2 T C 7: 122,048,339 I241V probably benign Het
Eml6 T C 11: 29,802,489 T975A probably damaging Het
Ephb2 T C 4: 136,660,810 T660A probably benign Het
Fbxw7 G A 3: 84,965,314 V268M Het
Gart A G 16: 91,636,538 F289S probably damaging Het
Gmcl1 G T 6: 86,704,538 N391K probably benign Het
Greb1l A C 18: 10,533,031 Q975P probably damaging Het
Greb1l G T 18: 10,533,032 Q975H probably benign Het
Grik5 C A 7: 25,010,694 R872L probably damaging Het
Hook1 A T 4: 96,014,852 D526V probably damaging Het
Ifna4 A T 4: 88,841,954 N32Y probably damaging Het
Ighg2b T A 12: 113,306,872 N213Y unknown Het
Itih4 G A 14: 30,901,170 V900I probably benign Het
Itpr2 A T 6: 146,373,173 F837Y probably damaging Het
Kif3a T C 11: 53,579,114 V147A probably benign Het
Klra9 T A 6: 130,191,321 probably benign Het
Lamp3 G T 16: 19,673,460 Q345K probably benign Het
Ltbp3 G A 19: 5,757,794 E1188K probably damaging Het
Med1 T A 11: 98,158,417 I518L probably benign Het
Mis18bp1 T C 12: 65,158,673 T242A probably damaging Het
Nemp1 T A 10: 127,696,254 F392Y probably benign Het
Obscn C A 11: 59,060,976 G3984W probably damaging Het
Obscn T A 11: 59,069,834 H3217L possibly damaging Het
Olfr1157 C T 2: 87,962,458 V145M possibly damaging Het
Olfr1328 A G 4: 118,934,626 M74T probably benign Het
Olfr1532-ps1 C T 7: 106,914,929 H244Y probably damaging Het
Olfr709-ps1 T C 7: 106,926,842 I206V probably benign Het
Olfr71 A G 4: 43,706,464 Y35H probably damaging Het
P4ha1 G T 10: 59,350,472 A258S probably benign Het
Parn T C 16: 13,607,281 I423V probably benign Het
Pcdh20 C A 14: 88,467,308 S852I probably damaging Het
Pcnx3 A G 19: 5,672,756 probably null Het
Pcsk1 A T 13: 75,112,650 I331F probably damaging Het
Pkd1l2 G T 8: 117,022,022 S1803R probably benign Het
Pkd1l3 C A 8: 109,660,801 N1792K probably damaging Het
Plekhg1 C A 10: 3,963,469 Q1119K Het
Prr30 T A 14: 101,198,935 T64S probably benign Het
Rec114 T C 9: 58,660,370 N111S probably benign Het
Reck G A 4: 43,895,850 V79I probably benign Het
Rexo1 A G 10: 80,550,397 F276L probably damaging Het
Rgs6 T C 12: 83,091,779 Y296H probably damaging Het
Sdk1 A G 5: 142,212,038 R2149G probably benign Het
Slc20a2 C A 8: 22,535,382 F33L probably damaging Het
Spopl T A 2: 23,545,449 T25S probably damaging Het
Srcap A T 7: 127,549,320 I1947F possibly damaging Het
Srek1 A C 13: 103,744,783 probably null Het
St8sia1 C T 6: 142,829,252 W200* probably null Het
Tas2r106 A T 6: 131,678,502 F129I possibly damaging Het
Tbrg4 A T 11: 6,620,857 L205Q probably damaging Het
Tchh C A 3: 93,445,880 R876S unknown Het
Thap12 G T 7: 98,715,038 A138S probably benign Het
Tjp1 C T 7: 65,343,614 probably null Het
Traf4 G A 11: 78,161,534 P95L probably benign Het
Trappc9 ATCTC ATCTCTC 15: 73,031,598 probably null Het
Usp20 G A 2: 31,017,486 V677M possibly damaging Het
Usp50 C A 2: 126,783,316 probably benign Het
Vmn1r21 T C 6: 57,844,322 T46A probably benign Het
Vmn2r54 T A 7: 12,629,742 H408L probably benign Het
Zfp266 T C 9: 20,506,003 T30A probably benign Het
Zfp536 T C 7: 37,479,757 H1141R probably benign Het
Other mutations in Hmox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0014:Hmox2 UTSW 16 4765033 missense probably damaging 0.99
R0014:Hmox2 UTSW 16 4765033 missense probably damaging 0.99
R0396:Hmox2 UTSW 16 4765763 missense probably benign 0.02
R2323:Hmox2 UTSW 16 4765856 nonsense probably null
R5913:Hmox2 UTSW 16 4764868 missense probably damaging 1.00
Z1177:Hmox2 UTSW 16 4757128 intron probably benign
Predicted Primers PCR Primer
(F):5'- ATGCTTATACTCGTTACATGGGG -3'
(R):5'- ATGGCTAACTGGTTCCCTCAC -3'

Sequencing Primer
(F):5'- GGACCTTTCAGGAGGCCAG -3'
(R):5'- CTCACCTTTTTCTAGGGCATGTAGG -3'
Posted On2019-06-07