Incidental Mutation 'PIT4453001:Lamp3'
ID555359
Institutional Source Beutler Lab
Gene Symbol Lamp3
Ensembl Gene ENSMUSG00000041247
Gene Namelysosomal-associated membrane protein 3
SynonymsCd208, DC-LAMP, 1200002D17Rik, TSC403
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4453001 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location19653378-19706375 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 19673460 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 345 (Q345K)
Ref Sequence ENSEMBL: ENSMUSP00000080556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081880]
Predicted Effect probably benign
Transcript: ENSMUST00000081880
AA Change: Q345K

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000080556
Gene: ENSMUSG00000041247
AA Change: Q345K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Lamp 103 411 5.6e-75 PFAM
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.9%
  • 10x: 85.6%
  • 20x: 74.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dendritic cells (DCs) are the most potent antigen-presenting cells. Immature DCs efficiently capture antigens and differentiate into interdigitating dendritic cells (IDCs) in lymphoid tissues that induce primary T-cell responses (summary by de Saint-Vis et al., 1998 [PubMed 9768752]).[supplied by OMIM, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T G 3: 122,105,316 I649S probably damaging Het
Abcc2 T A 19: 43,803,782 L334* probably null Het
Adam28 A T 14: 68,634,876 S306T probably benign Het
Adam34 T A 8: 43,651,312 D432V probably damaging Het
Adcy7 A G 8: 88,323,636 Y723C probably benign Het
Adgre5 T A 8: 83,724,460 M713L probably benign Het
Aebp2 C A 6: 140,637,686 C295* probably null Het
Amn1 G T 6: 149,170,859 Q127K probably benign Het
Atcay C T 10: 81,210,549 V314M probably damaging Het
Atp1a1 T C 3: 101,581,179 E847G probably benign Het
Atp2b1 A G 10: 99,016,978 E1039G probably benign Het
Caskin1 A G 17: 24,499,292 Y292C probably damaging Het
Cftr A G 6: 18,214,106 T94A probably damaging Het
Ciart T A 3: 95,880,476 K182M probably damaging Het
Col1a2 A C 6: 4,527,079 S603R possibly damaging Het
Cspp1 C A 1: 10,074,872 S298R possibly damaging Het
Cul7 T A 17: 46,651,820 C126S probably damaging Het
Cyp2c55 A T 19: 39,011,791 I145F probably damaging Het
Cypt4 G C 9: 24,625,474 A87P probably damaging Het
Disp2 G A 2: 118,787,644 V224M probably benign Het
Dlgap5 TTC T 14: 47,401,522 probably null Het
Dock1 A G 7: 135,152,300 K1602R probably benign Het
Ears2 T C 7: 122,048,339 I241V probably benign Het
Eml6 T C 11: 29,802,489 T975A probably damaging Het
Ephb2 T C 4: 136,660,810 T660A probably benign Het
Fbxw7 G A 3: 84,965,314 V268M Het
Gart A G 16: 91,636,538 F289S probably damaging Het
Gmcl1 G T 6: 86,704,538 N391K probably benign Het
Greb1l G T 18: 10,533,032 Q975H probably benign Het
Greb1l A C 18: 10,533,031 Q975P probably damaging Het
Grik5 C A 7: 25,010,694 R872L probably damaging Het
Hmox2 T A 16: 4,765,057 I218N probably damaging Het
Hook1 A T 4: 96,014,852 D526V probably damaging Het
Ifna4 A T 4: 88,841,954 N32Y probably damaging Het
Ighg2b T A 12: 113,306,872 N213Y unknown Het
Itih4 G A 14: 30,901,170 V900I probably benign Het
Itpr2 A T 6: 146,373,173 F837Y probably damaging Het
Kif3a T C 11: 53,579,114 V147A probably benign Het
Klra9 T A 6: 130,191,321 probably benign Het
Ltbp3 G A 19: 5,757,794 E1188K probably damaging Het
Med1 T A 11: 98,158,417 I518L probably benign Het
Mis18bp1 T C 12: 65,158,673 T242A probably damaging Het
Nemp1 T A 10: 127,696,254 F392Y probably benign Het
Obscn T A 11: 59,069,834 H3217L possibly damaging Het
Obscn C A 11: 59,060,976 G3984W probably damaging Het
Olfr1157 C T 2: 87,962,458 V145M possibly damaging Het
Olfr1328 A G 4: 118,934,626 M74T probably benign Het
Olfr1532-ps1 C T 7: 106,914,929 H244Y probably damaging Het
Olfr709-ps1 T C 7: 106,926,842 I206V probably benign Het
Olfr71 A G 4: 43,706,464 Y35H probably damaging Het
P4ha1 G T 10: 59,350,472 A258S probably benign Het
Parn T C 16: 13,607,281 I423V probably benign Het
Pcdh20 C A 14: 88,467,308 S852I probably damaging Het
Pcnx3 A G 19: 5,672,756 probably null Het
Pcsk1 A T 13: 75,112,650 I331F probably damaging Het
Pkd1l2 G T 8: 117,022,022 S1803R probably benign Het
Pkd1l3 C A 8: 109,660,801 N1792K probably damaging Het
Plekhg1 C A 10: 3,963,469 Q1119K Het
Prr30 T A 14: 101,198,935 T64S probably benign Het
Rec114 T C 9: 58,660,370 N111S probably benign Het
Reck G A 4: 43,895,850 V79I probably benign Het
Rexo1 A G 10: 80,550,397 F276L probably damaging Het
Rgs6 T C 12: 83,091,779 Y296H probably damaging Het
Sdk1 A G 5: 142,212,038 R2149G probably benign Het
Slc20a2 C A 8: 22,535,382 F33L probably damaging Het
Spopl T A 2: 23,545,449 T25S probably damaging Het
Srcap A T 7: 127,549,320 I1947F possibly damaging Het
Srek1 A C 13: 103,744,783 probably null Het
St8sia1 C T 6: 142,829,252 W200* probably null Het
Tas2r106 A T 6: 131,678,502 F129I possibly damaging Het
Tbrg4 A T 11: 6,620,857 L205Q probably damaging Het
Tchh C A 3: 93,445,880 R876S unknown Het
Thap12 G T 7: 98,715,038 A138S probably benign Het
Tjp1 C T 7: 65,343,614 probably null Het
Traf4 G A 11: 78,161,534 P95L probably benign Het
Trappc9 ATCTC ATCTCTC 15: 73,031,598 probably null Het
Usp20 G A 2: 31,017,486 V677M possibly damaging Het
Usp50 C A 2: 126,783,316 probably benign Het
Vmn1r21 T C 6: 57,844,322 T46A probably benign Het
Vmn2r54 T A 7: 12,629,742 H408L probably benign Het
Zfp266 T C 9: 20,506,003 T30A probably benign Het
Zfp536 T C 7: 37,479,757 H1141R probably benign Het
Other mutations in Lamp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01901:Lamp3 APN 16 19673419 missense probably damaging 1.00
IGL02505:Lamp3 APN 16 19655457 missense possibly damaging 0.48
IGL02892:Lamp3 APN 16 19676052 missense probably damaging 1.00
IGL03228:Lamp3 APN 16 19676067 missense possibly damaging 0.94
R0295:Lamp3 UTSW 16 19701108 nonsense probably null
R0419:Lamp3 UTSW 16 19673552 missense probably damaging 1.00
R1568:Lamp3 UTSW 16 19673525 missense probably damaging 1.00
R1702:Lamp3 UTSW 16 19676072 missense probably benign 0.11
R2018:Lamp3 UTSW 16 19701211 missense probably benign 0.02
R2019:Lamp3 UTSW 16 19701211 missense probably benign 0.02
R4072:Lamp3 UTSW 16 19700716 missense possibly damaging 0.89
R4073:Lamp3 UTSW 16 19700716 missense possibly damaging 0.89
R4075:Lamp3 UTSW 16 19700716 missense possibly damaging 0.89
R4076:Lamp3 UTSW 16 19700716 missense possibly damaging 0.89
R4333:Lamp3 UTSW 16 19673436 missense probably benign 0.02
R4457:Lamp3 UTSW 16 19673529 missense probably benign 0.19
R4868:Lamp3 UTSW 16 19701290 missense probably benign 0.01
R4876:Lamp3 UTSW 16 19655470 missense probably damaging 0.97
R5766:Lamp3 UTSW 16 19701317 missense probably damaging 0.99
R5832:Lamp3 UTSW 16 19701320 missense probably damaging 0.98
R5997:Lamp3 UTSW 16 19701028 missense probably benign 0.22
R6000:Lamp3 UTSW 16 19700948 missense possibly damaging 0.88
R6088:Lamp3 UTSW 16 19673398 missense probably damaging 1.00
R6332:Lamp3 UTSW 16 19699681 missense probably damaging 1.00
R6636:Lamp3 UTSW 16 19701233 missense probably benign
R6637:Lamp3 UTSW 16 19701233 missense probably benign
R6881:Lamp3 UTSW 16 19699618 missense probably benign 0.39
R6966:Lamp3 UTSW 16 19699653 nonsense probably null
R7002:Lamp3 UTSW 16 19655422 missense possibly damaging 0.89
R7067:Lamp3 UTSW 16 19699663 missense probably damaging 0.99
R7425:Lamp3 UTSW 16 19699612 critical splice donor site probably null
R7781:Lamp3 UTSW 16 19699690 missense possibly damaging 0.86
R7866:Lamp3 UTSW 16 19699740 missense probably benign 0.01
R7894:Lamp3 UTSW 16 19655391 missense probably damaging 1.00
R7912:Lamp3 UTSW 16 19655497 missense probably damaging 1.00
R8036:Lamp3 UTSW 16 19701059 missense probably damaging 1.00
RF018:Lamp3 UTSW 16 19701250 missense probably benign
X0025:Lamp3 UTSW 16 19701056 missense possibly damaging 0.82
X0063:Lamp3 UTSW 16 19700885 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTAAACCACATGATCTGGCCC -3'
(R):5'- GCAGGACTCTAAGGTTACCC -3'

Sequencing Primer
(F):5'- ACATGATCTGGCCCCTTGACAG -3'
(R):5'- GGACTCTAAGGTTACCCCAACTGATG -3'
Posted On2019-06-07