Incidental Mutation 'PIT4453001:Greb1l'
ID555364
Institutional Source Beutler Lab
Gene Symbol Greb1l
Ensembl Gene ENSMUSG00000042942
Gene Namegrowth regulation by estrogen in breast cancer-like
SynonymsAK220484, mKIAA4095
Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4453001 (G1)
Quality Score222.009
Status Not validated
Chromosome18
Chromosomal Location10325177-10562934 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 10533032 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 975 (Q975H)
Ref Sequence ENSEMBL: ENSMUSP00000049003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532] [ENSMUST00000172680]
Predicted Effect probably benign
Transcript: ENSMUST00000048977
AA Change: Q975H

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: Q975H

DomainStartEndE-ValueType
Pfam:GREB1 1 1172 N/A PFAM
Pfam:GREB1 1154 1913 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000172532
AA Change: Q866H

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942
AA Change: Q866H

DomainStartEndE-ValueType
low complexity region 83 100 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172680
SMART Domains Protein: ENSMUSP00000134314
Gene: ENSMUSG00000042942

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.9%
  • 10x: 85.6%
  • 20x: 74.1%
Validation Efficiency
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T G 3: 122,105,316 I649S probably damaging Het
Abcc2 T A 19: 43,803,782 L334* probably null Het
Adam28 A T 14: 68,634,876 S306T probably benign Het
Adam34 T A 8: 43,651,312 D432V probably damaging Het
Adcy7 A G 8: 88,323,636 Y723C probably benign Het
Adgre5 T A 8: 83,724,460 M713L probably benign Het
Aebp2 C A 6: 140,637,686 C295* probably null Het
Amn1 G T 6: 149,170,859 Q127K probably benign Het
Atcay C T 10: 81,210,549 V314M probably damaging Het
Atp1a1 T C 3: 101,581,179 E847G probably benign Het
Atp2b1 A G 10: 99,016,978 E1039G probably benign Het
Caskin1 A G 17: 24,499,292 Y292C probably damaging Het
Cftr A G 6: 18,214,106 T94A probably damaging Het
Ciart T A 3: 95,880,476 K182M probably damaging Het
Col1a2 A C 6: 4,527,079 S603R possibly damaging Het
Cspp1 C A 1: 10,074,872 S298R possibly damaging Het
Cul7 T A 17: 46,651,820 C126S probably damaging Het
Cyp2c55 A T 19: 39,011,791 I145F probably damaging Het
Cypt4 G C 9: 24,625,474 A87P probably damaging Het
Disp2 G A 2: 118,787,644 V224M probably benign Het
Dlgap5 TTC T 14: 47,401,522 probably null Het
Dock1 A G 7: 135,152,300 K1602R probably benign Het
Ears2 T C 7: 122,048,339 I241V probably benign Het
Eml6 T C 11: 29,802,489 T975A probably damaging Het
Ephb2 T C 4: 136,660,810 T660A probably benign Het
Fbxw7 G A 3: 84,965,314 V268M Het
Gart A G 16: 91,636,538 F289S probably damaging Het
Gmcl1 G T 6: 86,704,538 N391K probably benign Het
Grik5 C A 7: 25,010,694 R872L probably damaging Het
Hmox2 T A 16: 4,765,057 I218N probably damaging Het
Hook1 A T 4: 96,014,852 D526V probably damaging Het
Ifna4 A T 4: 88,841,954 N32Y probably damaging Het
Ighg2b T A 12: 113,306,872 N213Y unknown Het
Itih4 G A 14: 30,901,170 V900I probably benign Het
Itpr2 A T 6: 146,373,173 F837Y probably damaging Het
Kif3a T C 11: 53,579,114 V147A probably benign Het
Klra9 T A 6: 130,191,321 probably benign Het
Lamp3 G T 16: 19,673,460 Q345K probably benign Het
Ltbp3 G A 19: 5,757,794 E1188K probably damaging Het
Med1 T A 11: 98,158,417 I518L probably benign Het
Mis18bp1 T C 12: 65,158,673 T242A probably damaging Het
Nemp1 T A 10: 127,696,254 F392Y probably benign Het
Obscn C A 11: 59,060,976 G3984W probably damaging Het
Obscn T A 11: 59,069,834 H3217L possibly damaging Het
Olfr1157 C T 2: 87,962,458 V145M possibly damaging Het
Olfr1328 A G 4: 118,934,626 M74T probably benign Het
Olfr1532-ps1 C T 7: 106,914,929 H244Y probably damaging Het
Olfr709-ps1 T C 7: 106,926,842 I206V probably benign Het
Olfr71 A G 4: 43,706,464 Y35H probably damaging Het
P4ha1 G T 10: 59,350,472 A258S probably benign Het
Parn T C 16: 13,607,281 I423V probably benign Het
Pcdh20 C A 14: 88,467,308 S852I probably damaging Het
Pcnx3 A G 19: 5,672,756 probably null Het
Pcsk1 A T 13: 75,112,650 I331F probably damaging Het
Pkd1l2 G T 8: 117,022,022 S1803R probably benign Het
Pkd1l3 C A 8: 109,660,801 N1792K probably damaging Het
Plekhg1 C A 10: 3,963,469 Q1119K Het
Prr30 T A 14: 101,198,935 T64S probably benign Het
Rec114 T C 9: 58,660,370 N111S probably benign Het
Reck G A 4: 43,895,850 V79I probably benign Het
Rexo1 A G 10: 80,550,397 F276L probably damaging Het
Rgs6 T C 12: 83,091,779 Y296H probably damaging Het
Sdk1 A G 5: 142,212,038 R2149G probably benign Het
Slc20a2 C A 8: 22,535,382 F33L probably damaging Het
Spopl T A 2: 23,545,449 T25S probably damaging Het
Srcap A T 7: 127,549,320 I1947F possibly damaging Het
Srek1 A C 13: 103,744,783 probably null Het
St8sia1 C T 6: 142,829,252 W200* probably null Het
Tas2r106 A T 6: 131,678,502 F129I possibly damaging Het
Tbrg4 A T 11: 6,620,857 L205Q probably damaging Het
Tchh C A 3: 93,445,880 R876S unknown Het
Thap12 G T 7: 98,715,038 A138S probably benign Het
Tjp1 C T 7: 65,343,614 probably null Het
Traf4 G A 11: 78,161,534 P95L probably benign Het
Trappc9 ATCTC ATCTCTC 15: 73,031,598 probably null Het
Usp20 G A 2: 31,017,486 V677M possibly damaging Het
Usp50 C A 2: 126,783,316 probably benign Het
Vmn1r21 T C 6: 57,844,322 T46A probably benign Het
Vmn2r54 T A 7: 12,629,742 H408L probably benign Het
Zfp266 T C 9: 20,506,003 T30A probably benign Het
Zfp536 T C 7: 37,479,757 H1141R probably benign Het
Other mutations in Greb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Greb1l APN 18 10555962 missense possibly damaging 0.90
IGL01554:Greb1l APN 18 10522144 missense probably benign 0.01
IGL01563:Greb1l APN 18 10469399 missense probably damaging 0.99
IGL01944:Greb1l APN 18 10557280 missense possibly damaging 0.91
IGL02110:Greb1l APN 18 10515271 missense probably damaging 1.00
IGL02249:Greb1l APN 18 10532961 missense probably damaging 1.00
IGL02318:Greb1l APN 18 10469388 missense possibly damaging 0.91
IGL02340:Greb1l APN 18 10515200 missense probably damaging 0.99
IGL02516:Greb1l APN 18 10537064 missense probably benign 0.31
IGL02566:Greb1l APN 18 10503299 missense probably damaging 0.99
IGL02583:Greb1l APN 18 10542362 missense probably damaging 1.00
IGL02838:Greb1l APN 18 10560430 missense probably damaging 1.00
A4554:Greb1l UTSW 18 10532862 missense possibly damaging 0.58
PIT4453001:Greb1l UTSW 18 10533031 missense probably damaging 0.98
R0099:Greb1l UTSW 18 10509158 missense probably damaging 1.00
R0226:Greb1l UTSW 18 10522076 intron probably benign
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0239:Greb1l UTSW 18 10458567 splice site probably benign
R0316:Greb1l UTSW 18 10547420 missense probably damaging 1.00
R0369:Greb1l UTSW 18 10469375 missense possibly damaging 0.80
R0394:Greb1l UTSW 18 10523374 missense probably damaging 0.99
R0478:Greb1l UTSW 18 10509281 missense probably damaging 1.00
R0555:Greb1l UTSW 18 10458781 splice site probably benign
R0671:Greb1l UTSW 18 10474303 missense probably damaging 1.00
R1282:Greb1l UTSW 18 10547289 missense probably benign 0.13
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1607:Greb1l UTSW 18 10529703 missense possibly damaging 0.85
R1666:Greb1l UTSW 18 10501080 critical splice donor site probably null
R1666:Greb1l UTSW 18 10529708 critical splice donor site probably null
R1720:Greb1l UTSW 18 10553848 missense probably benign 0.19
R1808:Greb1l UTSW 18 10542143 missense probably benign
R1829:Greb1l UTSW 18 10509314 missense probably damaging 1.00
R1897:Greb1l UTSW 18 10498992 missense probably benign 0.00
R1967:Greb1l UTSW 18 10501049 missense possibly damaging 0.91
R2025:Greb1l UTSW 18 10515221 missense possibly damaging 0.71
R2086:Greb1l UTSW 18 10523281 missense probably damaging 1.00
R2125:Greb1l UTSW 18 10511422 missense probably damaging 0.98
R2139:Greb1l UTSW 18 10555011 missense probably damaging 1.00
R2255:Greb1l UTSW 18 10554857 missense probably damaging 1.00
R2256:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2257:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2880:Greb1l UTSW 18 10547288 missense possibly damaging 0.93
R3623:Greb1l UTSW 18 10542380 missense probably damaging 0.99
R3778:Greb1l UTSW 18 10469444 missense possibly damaging 0.60
R3975:Greb1l UTSW 18 10522247 missense possibly damaging 0.71
R4038:Greb1l UTSW 18 10515209 missense possibly damaging 0.93
R4062:Greb1l UTSW 18 10522150 missense probably damaging 0.99
R4134:Greb1l UTSW 18 10529708 critical splice donor site probably null
R4342:Greb1l UTSW 18 10544561 missense probably benign 0.12
R4409:Greb1l UTSW 18 10503182 missense possibly damaging 0.70
R4600:Greb1l UTSW 18 10553705 missense probably damaging 1.00
R4618:Greb1l UTSW 18 10498965 missense probably benign 0.00
R4683:Greb1l UTSW 18 10529563 splice site probably null
R4686:Greb1l UTSW 18 10522112 missense probably damaging 0.98
R4707:Greb1l UTSW 18 10532922 missense probably benign 0.02
R4780:Greb1l UTSW 18 10541792 missense probably benign 0.00
R4819:Greb1l UTSW 18 10458358 missense probably damaging 1.00
R4925:Greb1l UTSW 18 10547447 missense possibly damaging 0.79
R4960:Greb1l UTSW 18 10547306 missense probably damaging 0.99
R5150:Greb1l UTSW 18 10555950 frame shift probably null
R5154:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5269:Greb1l UTSW 18 10511409 missense probably benign
R5290:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5310:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5328:Greb1l UTSW 18 10553720 missense probably damaging 1.00
R5337:Greb1l UTSW 18 10509143 missense probably damaging 1.00
R5393:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5402:Greb1l UTSW 18 10537169 missense probably benign 0.26
R5718:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5719:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5720:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5721:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5902:Greb1l UTSW 18 10538302 missense probably benign 0.00
R5993:Greb1l UTSW 18 10544455 missense probably benign 0.10
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6045:Greb1l UTSW 18 10547068 missense probably damaging 1.00
R6063:Greb1l UTSW 18 10557340 missense probably damaging 1.00
R6297:Greb1l UTSW 18 10469494 missense probably damaging 1.00
R6405:Greb1l UTSW 18 10501076 missense probably benign 0.30
R6552:Greb1l UTSW 18 10541814 missense probably benign 0.00
R6572:Greb1l UTSW 18 10522131 missense probably benign 0.07
R6575:Greb1l UTSW 18 10547347 missense possibly damaging 0.88
R6922:Greb1l UTSW 18 10547482 missense possibly damaging 0.88
R6957:Greb1l UTSW 18 10558786 missense probably benign 0.23
R6962:Greb1l UTSW 18 10547327 missense probably damaging 1.00
R7012:Greb1l UTSW 18 10529707 critical splice donor site probably null
R7179:Greb1l UTSW 18 10544576 missense probably benign 0.00
R7251:Greb1l UTSW 18 10515319 missense probably damaging 1.00
R7275:Greb1l UTSW 18 10544561 missense probably benign 0.12
R7301:Greb1l UTSW 18 10544970 missense probably damaging 1.00
R7307:Greb1l UTSW 18 10538142 missense probably damaging 0.99
R7455:Greb1l UTSW 18 10554915 missense probably damaging 1.00
R7832:Greb1l UTSW 18 10542056 missense probably benign 0.38
R7934:Greb1l UTSW 18 10474371 nonsense probably null
R8137:Greb1l UTSW 18 10474357 missense possibly damaging 0.77
R8138:Greb1l UTSW 18 10533060 missense probably benign 0.13
R8208:Greb1l UTSW 18 10510703 missense probably damaging 1.00
R8227:Greb1l UTSW 18 10515371 missense probably damaging 1.00
R8312:Greb1l UTSW 18 10511587 intron probably benign
R8331:Greb1l UTSW 18 10458706 missense possibly damaging 0.96
R8364:Greb1l UTSW 18 10529687 missense possibly damaging 0.85
R8389:Greb1l UTSW 18 10529613 missense probably benign 0.00
Z1176:Greb1l UTSW 18 10515305 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGCTCTCACCACTATGGC -3'
(R):5'- CAGTGCGTCCTTTCATTTAGCTTAG -3'

Sequencing Primer
(F):5'- TATGGCGTCCCTCCGAGAC -3'
(R):5'- ATTTAGCTTAGCCTGGCCAG -3'
Posted On2019-06-07