Incidental Mutation 'PIT4453001:Ltbp3'
ID555366
Institutional Source Beutler Lab
Gene Symbol Ltbp3
Ensembl Gene ENSMUSG00000024940
Gene Namelatent transforming growth factor beta binding protein 3
SynonymsLtbp2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.235) question?
Stock #PIT4453001 (G1)
Quality Score215.009
Status Not validated
Chromosome19
Chromosomal Location5740904-5758532 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 5757794 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1188 (E1188K)
Ref Sequence ENSEMBL: ENSMUSP00000080214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025890] [ENSMUST00000081496]
Predicted Effect probably benign
Transcript: ENSMUST00000025890
SMART Domains Protein: ENSMUSP00000025890
Gene: ENSMUSG00000024941

DomainStartEndE-ValueType
low complexity region 18 28 N/A INTRINSIC
Pfam:Pkinase_Tyr 30 254 3.3e-11 PFAM
Pfam:Pkinase 31 252 2e-14 PFAM
SCOP:d1gw5a_ 350 536 1e-18 SMART
low complexity region 556 577 N/A INTRINSIC
low complexity region 608 620 N/A INTRINSIC
coiled coil region 759 795 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000081496
AA Change: E1188K

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000080214
Gene: ENSMUSG00000024940
AA Change: E1188K

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
EGF 109 138 6.76e-3 SMART
low complexity region 140 154 N/A INTRINSIC
low complexity region 191 199 N/A INTRINSIC
low complexity region 221 233 N/A INTRINSIC
low complexity region 254 273 N/A INTRINSIC
Pfam:TB 286 323 8e-9 PFAM
EGF_CA 352 392 2.08e-12 SMART
Pfam:TB 411 451 4.8e-18 PFAM
low complexity region 526 537 N/A INTRINSIC
EGF_CA 571 612 8.71e-6 SMART
EGF_CA 613 656 2.8e-9 SMART
EGF_CA 657 699 2.48e-10 SMART
EGF_CA 700 740 4.96e-10 SMART
EGF_CA 741 781 1.69e-12 SMART
EGF_CA 782 822 1.94e-12 SMART
EGF_CA 823 862 3.27e-10 SMART
EGF_CA 863 905 3.32e-11 SMART
Pfam:TB 925 967 5.7e-16 PFAM
EGF_CA 990 1032 4.49e-8 SMART
EGF_CA 1033 1073 3.17e-8 SMART
Pfam:TB 1097 1134 1.2e-11 PFAM
EGF 1170 1203 1.53e1 SMART
EGF_CA 1204 1248 1.53e-10 SMART
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.9%
  • 10x: 85.6%
  • 20x: 74.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a complex with transforming growth factor beta (TGF-beta) proteins and may be involved in their subcellular localization. Activation of this complex requires removal of the encoded binding protein. This protein also may play a structural role in the extracellular matrix. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit craniofacial malformations including an overshot mandible and ossification of synchondroses. Mutants develop osteosclerosis of long bones and osteoarthritis, and, in some cases, high corticosterone levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T G 3: 122,105,316 I649S probably damaging Het
Abcc2 T A 19: 43,803,782 L334* probably null Het
Adam28 A T 14: 68,634,876 S306T probably benign Het
Adam34 T A 8: 43,651,312 D432V probably damaging Het
Adcy7 A G 8: 88,323,636 Y723C probably benign Het
Adgre5 T A 8: 83,724,460 M713L probably benign Het
Aebp2 C A 6: 140,637,686 C295* probably null Het
Amn1 G T 6: 149,170,859 Q127K probably benign Het
Atcay C T 10: 81,210,549 V314M probably damaging Het
Atp1a1 T C 3: 101,581,179 E847G probably benign Het
Atp2b1 A G 10: 99,016,978 E1039G probably benign Het
Caskin1 A G 17: 24,499,292 Y292C probably damaging Het
Cftr A G 6: 18,214,106 T94A probably damaging Het
Ciart T A 3: 95,880,476 K182M probably damaging Het
Col1a2 A C 6: 4,527,079 S603R possibly damaging Het
Cspp1 C A 1: 10,074,872 S298R possibly damaging Het
Cul7 T A 17: 46,651,820 C126S probably damaging Het
Cyp2c55 A T 19: 39,011,791 I145F probably damaging Het
Cypt4 G C 9: 24,625,474 A87P probably damaging Het
Disp2 G A 2: 118,787,644 V224M probably benign Het
Dlgap5 TTC T 14: 47,401,522 probably null Het
Dock1 A G 7: 135,152,300 K1602R probably benign Het
Ears2 T C 7: 122,048,339 I241V probably benign Het
Eml6 T C 11: 29,802,489 T975A probably damaging Het
Ephb2 T C 4: 136,660,810 T660A probably benign Het
Fbxw7 G A 3: 84,965,314 V268M Het
Gart A G 16: 91,636,538 F289S probably damaging Het
Gmcl1 G T 6: 86,704,538 N391K probably benign Het
Greb1l A C 18: 10,533,031 Q975P probably damaging Het
Greb1l G T 18: 10,533,032 Q975H probably benign Het
Grik5 C A 7: 25,010,694 R872L probably damaging Het
Hmox2 T A 16: 4,765,057 I218N probably damaging Het
Hook1 A T 4: 96,014,852 D526V probably damaging Het
Ifna4 A T 4: 88,841,954 N32Y probably damaging Het
Ighg2b T A 12: 113,306,872 N213Y unknown Het
Itih4 G A 14: 30,901,170 V900I probably benign Het
Itpr2 A T 6: 146,373,173 F837Y probably damaging Het
Kif3a T C 11: 53,579,114 V147A probably benign Het
Klra9 T A 6: 130,191,321 probably benign Het
Lamp3 G T 16: 19,673,460 Q345K probably benign Het
Med1 T A 11: 98,158,417 I518L probably benign Het
Mis18bp1 T C 12: 65,158,673 T242A probably damaging Het
Nemp1 T A 10: 127,696,254 F392Y probably benign Het
Obscn C A 11: 59,060,976 G3984W probably damaging Het
Obscn T A 11: 59,069,834 H3217L possibly damaging Het
Olfr1157 C T 2: 87,962,458 V145M possibly damaging Het
Olfr1328 A G 4: 118,934,626 M74T probably benign Het
Olfr1532-ps1 C T 7: 106,914,929 H244Y probably damaging Het
Olfr709-ps1 T C 7: 106,926,842 I206V probably benign Het
Olfr71 A G 4: 43,706,464 Y35H probably damaging Het
P4ha1 G T 10: 59,350,472 A258S probably benign Het
Parn T C 16: 13,607,281 I423V probably benign Het
Pcdh20 C A 14: 88,467,308 S852I probably damaging Het
Pcnx3 A G 19: 5,672,756 probably null Het
Pcsk1 A T 13: 75,112,650 I331F probably damaging Het
Pkd1l2 G T 8: 117,022,022 S1803R probably benign Het
Pkd1l3 C A 8: 109,660,801 N1792K probably damaging Het
Plekhg1 C A 10: 3,963,469 Q1119K Het
Prr30 T A 14: 101,198,935 T64S probably benign Het
Rec114 T C 9: 58,660,370 N111S probably benign Het
Reck G A 4: 43,895,850 V79I probably benign Het
Rexo1 A G 10: 80,550,397 F276L probably damaging Het
Rgs6 T C 12: 83,091,779 Y296H probably damaging Het
Sdk1 A G 5: 142,212,038 R2149G probably benign Het
Slc20a2 C A 8: 22,535,382 F33L probably damaging Het
Spopl T A 2: 23,545,449 T25S probably damaging Het
Srcap A T 7: 127,549,320 I1947F possibly damaging Het
Srek1 A C 13: 103,744,783 probably null Het
St8sia1 C T 6: 142,829,252 W200* probably null Het
Tas2r106 A T 6: 131,678,502 F129I possibly damaging Het
Tbrg4 A T 11: 6,620,857 L205Q probably damaging Het
Tchh C A 3: 93,445,880 R876S unknown Het
Thap12 G T 7: 98,715,038 A138S probably benign Het
Tjp1 C T 7: 65,343,614 probably null Het
Traf4 G A 11: 78,161,534 P95L probably benign Het
Trappc9 ATCTC ATCTCTC 15: 73,031,598 probably null Het
Usp20 G A 2: 31,017,486 V677M possibly damaging Het
Usp50 C A 2: 126,783,316 probably benign Het
Vmn1r21 T C 6: 57,844,322 T46A probably benign Het
Vmn2r54 T A 7: 12,629,742 H408L probably benign Het
Zfp266 T C 9: 20,506,003 T30A probably benign Het
Zfp536 T C 7: 37,479,757 H1141R probably benign Het
Other mutations in Ltbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Ltbp3 APN 19 5756016 missense probably damaging 0.99
IGL00978:Ltbp3 APN 19 5754019 missense probably benign 0.26
IGL01517:Ltbp3 APN 19 5757732 missense possibly damaging 0.57
IGL01529:Ltbp3 APN 19 5747839 missense probably benign 0.06
IGL03119:Ltbp3 APN 19 5757443 missense probably damaging 0.98
csp UTSW 19 5747688 missense probably damaging 1.00
lilia UTSW 19 5747857 critical splice donor site probably null
Rapunzel UTSW 19 5753942 nonsense probably null
PIT4305001:Ltbp3 UTSW 19 5752067 missense probably damaging 0.99
PIT4480001:Ltbp3 UTSW 19 5751226 missense possibly damaging 0.73
R0211:Ltbp3 UTSW 19 5752143 critical splice donor site probably null
R0718:Ltbp3 UTSW 19 5746748 splice site probably benign
R1103:Ltbp3 UTSW 19 5747411 critical splice acceptor site probably null
R1103:Ltbp3 UTSW 19 5747412 critical splice acceptor site probably null
R1299:Ltbp3 UTSW 19 5745428 splice site probably benign
R1510:Ltbp3 UTSW 19 5748887 missense probably benign 0.02
R1616:Ltbp3 UTSW 19 5746967 missense probably damaging 1.00
R1682:Ltbp3 UTSW 19 5751754 missense probably benign 0.02
R1752:Ltbp3 UTSW 19 5745657 missense probably benign 0.09
R1806:Ltbp3 UTSW 19 5753942 nonsense probably null
R1866:Ltbp3 UTSW 19 5747849 missense probably benign 0.43
R1981:Ltbp3 UTSW 19 5758079 missense probably benign 0.15
R2211:Ltbp3 UTSW 19 5753962 missense possibly damaging 0.79
R2239:Ltbp3 UTSW 19 5751523 nonsense probably null
R2261:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R2263:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R2380:Ltbp3 UTSW 19 5751523 nonsense probably null
R2412:Ltbp3 UTSW 19 5746645 missense probably benign 0.08
R2446:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R2449:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3056:Ltbp3 UTSW 19 5751406 missense probably benign 0.11
R3080:Ltbp3 UTSW 19 5756888 frame shift probably null
R3863:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3864:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3951:Ltbp3 UTSW 19 5756001 missense probably damaging 1.00
R3961:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3962:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3963:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3972:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R4028:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R4031:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R4041:Ltbp3 UTSW 19 5751871 missense possibly damaging 0.95
R4060:Ltbp3 UTSW 19 5742320 missense probably benign 0.41
R4296:Ltbp3 UTSW 19 5756582 critical splice acceptor site probably null
R4525:Ltbp3 UTSW 19 5746359 missense probably benign 0.09
R4660:Ltbp3 UTSW 19 5748786 intron probably null
R4794:Ltbp3 UTSW 19 5756679 missense probably damaging 1.00
R4980:Ltbp3 UTSW 19 5753927 critical splice acceptor site probably null
R5071:Ltbp3 UTSW 19 5756823 missense probably damaging 1.00
R5702:Ltbp3 UTSW 19 5747821 missense probably benign
R5771:Ltbp3 UTSW 19 5747544 missense probably damaging 1.00
R6021:Ltbp3 UTSW 19 5753680 missense probably benign 0.00
R6053:Ltbp3 UTSW 19 5752094 missense probably damaging 0.98
R6321:Ltbp3 UTSW 19 5745657 missense probably benign 0.09
R6339:Ltbp3 UTSW 19 5747477 missense probably damaging 1.00
R6371:Ltbp3 UTSW 19 5745772 splice site probably null
R6709:Ltbp3 UTSW 19 5747857 critical splice donor site probably null
R7666:Ltbp3 UTSW 19 5747006 missense possibly damaging 0.79
X0066:Ltbp3 UTSW 19 5751277 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAGTGAGAGCAATTCATTCTGGGAC -3'
(R):5'- TGGTTCAGTTCTCGGCACTC -3'

Sequencing Primer
(F):5'- GCAATTCATTCTGGGACACAAG -3'
(R):5'- CACTCATCAATGTCTGCAAGGTGG -3'
Posted On2019-06-07