Incidental Mutation 'PIT4453001:Ltbp3'
ID 555366
Institutional Source Beutler Lab
Gene Symbol Ltbp3
Ensembl Gene ENSMUSG00000024940
Gene Name latent transforming growth factor beta binding protein 3
Synonyms Ltbp2
Accession Numbers
Essential gene? Probably non essential (E-score: 0.198) question?
Stock # PIT4453001 (G1)
Quality Score 215.009
Status Not validated
Chromosome 19
Chromosomal Location 5790932-5808560 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 5807822 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1188 (E1188K)
Ref Sequence ENSEMBL: ENSMUSP00000080214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025890] [ENSMUST00000081496]
AlphaFold Q61810
Predicted Effect probably benign
Transcript: ENSMUST00000025890
SMART Domains Protein: ENSMUSP00000025890
Gene: ENSMUSG00000024941

DomainStartEndE-ValueType
low complexity region 18 28 N/A INTRINSIC
Pfam:Pkinase_Tyr 30 254 3.3e-11 PFAM
Pfam:Pkinase 31 252 2e-14 PFAM
SCOP:d1gw5a_ 350 536 1e-18 SMART
low complexity region 556 577 N/A INTRINSIC
low complexity region 608 620 N/A INTRINSIC
coiled coil region 759 795 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000081496
AA Change: E1188K

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000080214
Gene: ENSMUSG00000024940
AA Change: E1188K

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
EGF 109 138 6.76e-3 SMART
low complexity region 140 154 N/A INTRINSIC
low complexity region 191 199 N/A INTRINSIC
low complexity region 221 233 N/A INTRINSIC
low complexity region 254 273 N/A INTRINSIC
Pfam:TB 286 323 8e-9 PFAM
EGF_CA 352 392 2.08e-12 SMART
Pfam:TB 411 451 4.8e-18 PFAM
low complexity region 526 537 N/A INTRINSIC
EGF_CA 571 612 8.71e-6 SMART
EGF_CA 613 656 2.8e-9 SMART
EGF_CA 657 699 2.48e-10 SMART
EGF_CA 700 740 4.96e-10 SMART
EGF_CA 741 781 1.69e-12 SMART
EGF_CA 782 822 1.94e-12 SMART
EGF_CA 823 862 3.27e-10 SMART
EGF_CA 863 905 3.32e-11 SMART
Pfam:TB 925 967 5.7e-16 PFAM
EGF_CA 990 1032 4.49e-8 SMART
EGF_CA 1033 1073 3.17e-8 SMART
Pfam:TB 1097 1134 1.2e-11 PFAM
EGF 1170 1203 1.53e1 SMART
EGF_CA 1204 1248 1.53e-10 SMART
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.9%
  • 10x: 85.6%
  • 20x: 74.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a complex with transforming growth factor beta (TGF-beta) proteins and may be involved in their subcellular localization. Activation of this complex requires removal of the encoded binding protein. This protein also may play a structural role in the extracellular matrix. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit craniofacial malformations including an overshot mandible and ossification of synchondroses. Mutants develop osteosclerosis of long bones and osteoarthritis, and, in some cases, high corticosterone levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T G 3: 121,898,965 (GRCm39) I649S probably damaging Het
Abcc2 T A 19: 43,792,221 (GRCm39) L334* probably null Het
Adam28 A T 14: 68,872,325 (GRCm39) S306T probably benign Het
Adam34 T A 8: 44,104,349 (GRCm39) D432V probably damaging Het
Adcy7 A G 8: 89,050,264 (GRCm39) Y723C probably benign Het
Adgre5 T A 8: 84,451,089 (GRCm39) M713L probably benign Het
Aebp2 C A 6: 140,583,412 (GRCm39) C295* probably null Het
Amn1 G T 6: 149,072,357 (GRCm39) Q127K probably benign Het
Atcay C T 10: 81,046,383 (GRCm39) V314M probably damaging Het
Atp1a1 T C 3: 101,488,495 (GRCm39) E847G probably benign Het
Atp2b1 A G 10: 98,852,840 (GRCm39) E1039G probably benign Het
Caskin1 A G 17: 24,718,266 (GRCm39) Y292C probably damaging Het
Cftr A G 6: 18,214,105 (GRCm39) T94A probably damaging Het
Ciart T A 3: 95,787,788 (GRCm39) K182M probably damaging Het
Col1a2 A C 6: 4,527,079 (GRCm39) S603R possibly damaging Het
Cspp1 C A 1: 10,145,097 (GRCm39) S298R possibly damaging Het
Cul7 T A 17: 46,962,746 (GRCm39) C126S probably damaging Het
Cyp2c55 A T 19: 39,000,235 (GRCm39) I145F probably damaging Het
Cypt4 G C 9: 24,536,770 (GRCm39) A87P probably damaging Het
Disp2 G A 2: 118,618,125 (GRCm39) V224M probably benign Het
Dlgap5 TTC T 14: 47,638,979 (GRCm39) probably null Het
Dock1 A G 7: 134,754,029 (GRCm39) K1602R probably benign Het
Ears2 T C 7: 121,647,562 (GRCm39) I241V probably benign Het
Eml6 T C 11: 29,752,489 (GRCm39) T975A probably damaging Het
Ephb2 T C 4: 136,388,121 (GRCm39) T660A probably benign Het
Fbxw7 G A 3: 84,872,621 (GRCm39) V268M Het
Gart A G 16: 91,433,426 (GRCm39) F289S probably damaging Het
Gmcl1 G T 6: 86,681,520 (GRCm39) N391K probably benign Het
Greb1l A C 18: 10,533,031 (GRCm39) Q975P probably damaging Het
Greb1l G T 18: 10,533,032 (GRCm39) Q975H probably benign Het
Grik5 C A 7: 24,710,119 (GRCm39) R872L probably damaging Het
Hmox2 T A 16: 4,582,921 (GRCm39) I218N probably damaging Het
Hook1 A T 4: 95,903,089 (GRCm39) D526V probably damaging Het
Ifna4 A T 4: 88,760,191 (GRCm39) N32Y probably damaging Het
Ighg2b T A 12: 113,270,492 (GRCm39) N213Y unknown Het
Itih4 G A 14: 30,623,127 (GRCm39) V900I probably benign Het
Itpr2 A T 6: 146,274,671 (GRCm39) F837Y probably damaging Het
Kif3a T C 11: 53,469,941 (GRCm39) V147A probably benign Het
Klra9 T A 6: 130,168,284 (GRCm39) probably benign Het
Lamp3 G T 16: 19,492,210 (GRCm39) Q345K probably benign Het
Med1 T A 11: 98,049,243 (GRCm39) I518L probably benign Het
Mis18bp1 T C 12: 65,205,447 (GRCm39) T242A probably damaging Het
Nemp1 T A 10: 127,532,123 (GRCm39) F392Y probably benign Het
Obscn C A 11: 58,951,802 (GRCm39) G3984W probably damaging Het
Obscn T A 11: 58,960,660 (GRCm39) H3217L possibly damaging Het
Or10ak7 A G 4: 118,791,823 (GRCm39) M74T probably benign Het
Or13j1 A G 4: 43,706,464 (GRCm39) Y35H probably damaging Het
Or2d3b C T 7: 106,514,136 (GRCm39) H244Y probably damaging Het
Or2d3c T C 7: 106,526,049 (GRCm39) I206V probably benign Het
Or5l14 C T 2: 87,792,802 (GRCm39) V145M possibly damaging Het
P4ha1 G T 10: 59,186,294 (GRCm39) A258S probably benign Het
Parn T C 16: 13,425,145 (GRCm39) I423V probably benign Het
Pcdh20 C A 14: 88,704,744 (GRCm39) S852I probably damaging Het
Pcnx3 A G 19: 5,722,784 (GRCm39) probably null Het
Pcsk1 A T 13: 75,260,769 (GRCm39) I331F probably damaging Het
Pkd1l2 G T 8: 117,748,761 (GRCm39) S1803R probably benign Het
Pkd1l3 C A 8: 110,387,433 (GRCm39) N1792K probably damaging Het
Plekhg1 C A 10: 3,913,469 (GRCm39) Q1119K Het
Prr30 T A 14: 101,436,371 (GRCm39) T64S probably benign Het
Rec114 T C 9: 58,567,653 (GRCm39) N111S probably benign Het
Reck G A 4: 43,895,850 (GRCm39) V79I probably benign Het
Rexo1 A G 10: 80,386,231 (GRCm39) F276L probably damaging Het
Rgs6 T C 12: 83,138,553 (GRCm39) Y296H probably damaging Het
Sdk1 A G 5: 142,197,793 (GRCm39) R2149G probably benign Het
Slc20a2 C A 8: 23,025,398 (GRCm39) F33L probably damaging Het
Spopl T A 2: 23,435,461 (GRCm39) T25S probably damaging Het
Srcap A T 7: 127,148,492 (GRCm39) I1947F possibly damaging Het
Srek1 A C 13: 103,881,291 (GRCm39) probably null Het
St8sia1 C T 6: 142,774,978 (GRCm39) W200* probably null Het
Tas2r106 A T 6: 131,655,465 (GRCm39) F129I possibly damaging Het
Tbrg4 A T 11: 6,570,857 (GRCm39) L205Q probably damaging Het
Tchh C A 3: 93,353,187 (GRCm39) R876S unknown Het
Thap12 G T 7: 98,364,245 (GRCm39) A138S probably benign Het
Tjp1 C T 7: 64,993,362 (GRCm39) probably null Het
Traf4 G A 11: 78,052,360 (GRCm39) P95L probably benign Het
Trappc9 ATCTC ATCTCTC 15: 72,903,447 (GRCm39) probably null Het
Usp20 G A 2: 30,907,498 (GRCm39) V677M possibly damaging Het
Usp50 C A 2: 126,625,236 (GRCm39) probably benign Het
Vmn1r21 T C 6: 57,821,307 (GRCm39) T46A probably benign Het
Vmn2r54 T A 7: 12,363,669 (GRCm39) H408L probably benign Het
Zfp266 T C 9: 20,417,299 (GRCm39) T30A probably benign Het
Zfp536 T C 7: 37,179,182 (GRCm39) H1141R probably benign Het
Other mutations in Ltbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Ltbp3 APN 19 5,806,044 (GRCm39) missense probably damaging 0.99
IGL00978:Ltbp3 APN 19 5,804,047 (GRCm39) missense probably benign 0.26
IGL01517:Ltbp3 APN 19 5,807,760 (GRCm39) missense possibly damaging 0.57
IGL01529:Ltbp3 APN 19 5,797,867 (GRCm39) missense probably benign 0.06
IGL03119:Ltbp3 APN 19 5,807,471 (GRCm39) missense probably damaging 0.98
abner UTSW 19 5,795,685 (GRCm39) missense probably benign 0.09
csp UTSW 19 5,797,716 (GRCm39) missense probably damaging 1.00
lilia UTSW 19 5,797,885 (GRCm39) critical splice donor site probably null
Rapunzel UTSW 19 5,803,970 (GRCm39) nonsense probably null
PIT4305001:Ltbp3 UTSW 19 5,802,095 (GRCm39) missense probably damaging 0.99
PIT4480001:Ltbp3 UTSW 19 5,801,254 (GRCm39) missense possibly damaging 0.73
R0211:Ltbp3 UTSW 19 5,802,171 (GRCm39) critical splice donor site probably null
R0718:Ltbp3 UTSW 19 5,796,776 (GRCm39) splice site probably benign
R1103:Ltbp3 UTSW 19 5,797,440 (GRCm39) critical splice acceptor site probably null
R1103:Ltbp3 UTSW 19 5,797,439 (GRCm39) critical splice acceptor site probably null
R1299:Ltbp3 UTSW 19 5,795,456 (GRCm39) splice site probably benign
R1510:Ltbp3 UTSW 19 5,798,915 (GRCm39) missense probably benign 0.02
R1616:Ltbp3 UTSW 19 5,796,995 (GRCm39) missense probably damaging 1.00
R1682:Ltbp3 UTSW 19 5,801,782 (GRCm39) missense probably benign 0.02
R1752:Ltbp3 UTSW 19 5,795,685 (GRCm39) missense probably benign 0.09
R1806:Ltbp3 UTSW 19 5,803,970 (GRCm39) nonsense probably null
R1866:Ltbp3 UTSW 19 5,797,877 (GRCm39) missense probably benign 0.43
R1981:Ltbp3 UTSW 19 5,808,107 (GRCm39) missense probably benign 0.15
R2211:Ltbp3 UTSW 19 5,803,990 (GRCm39) missense possibly damaging 0.79
R2239:Ltbp3 UTSW 19 5,801,551 (GRCm39) nonsense probably null
R2261:Ltbp3 UTSW 19 5,804,050 (GRCm39) missense probably benign 0.02
R2263:Ltbp3 UTSW 19 5,804,050 (GRCm39) missense probably benign 0.02
R2380:Ltbp3 UTSW 19 5,801,551 (GRCm39) nonsense probably null
R2412:Ltbp3 UTSW 19 5,796,673 (GRCm39) missense probably benign 0.08
R2446:Ltbp3 UTSW 19 5,804,050 (GRCm39) missense probably benign 0.02
R2449:Ltbp3 UTSW 19 5,804,050 (GRCm39) missense probably benign 0.02
R3056:Ltbp3 UTSW 19 5,801,434 (GRCm39) missense probably benign 0.11
R3080:Ltbp3 UTSW 19 5,806,916 (GRCm39) frame shift probably null
R3863:Ltbp3 UTSW 19 5,804,050 (GRCm39) missense probably benign 0.02
R3864:Ltbp3 UTSW 19 5,804,050 (GRCm39) missense probably benign 0.02
R3951:Ltbp3 UTSW 19 5,806,029 (GRCm39) missense probably damaging 1.00
R3961:Ltbp3 UTSW 19 5,804,050 (GRCm39) missense probably benign 0.02
R3962:Ltbp3 UTSW 19 5,804,050 (GRCm39) missense probably benign 0.02
R3963:Ltbp3 UTSW 19 5,804,050 (GRCm39) missense probably benign 0.02
R3972:Ltbp3 UTSW 19 5,804,050 (GRCm39) missense probably benign 0.02
R4028:Ltbp3 UTSW 19 5,804,050 (GRCm39) missense probably benign 0.02
R4031:Ltbp3 UTSW 19 5,804,050 (GRCm39) missense probably benign 0.02
R4041:Ltbp3 UTSW 19 5,801,899 (GRCm39) missense possibly damaging 0.95
R4060:Ltbp3 UTSW 19 5,792,348 (GRCm39) missense probably benign 0.41
R4296:Ltbp3 UTSW 19 5,806,610 (GRCm39) critical splice acceptor site probably null
R4525:Ltbp3 UTSW 19 5,796,387 (GRCm39) missense probably benign 0.09
R4660:Ltbp3 UTSW 19 5,798,814 (GRCm39) splice site probably null
R4794:Ltbp3 UTSW 19 5,806,707 (GRCm39) missense probably damaging 1.00
R4980:Ltbp3 UTSW 19 5,803,955 (GRCm39) critical splice acceptor site probably null
R5071:Ltbp3 UTSW 19 5,806,851 (GRCm39) missense probably damaging 1.00
R5702:Ltbp3 UTSW 19 5,797,849 (GRCm39) missense probably benign
R5771:Ltbp3 UTSW 19 5,797,572 (GRCm39) missense probably damaging 1.00
R6021:Ltbp3 UTSW 19 5,803,708 (GRCm39) missense probably benign 0.00
R6053:Ltbp3 UTSW 19 5,802,122 (GRCm39) missense probably damaging 0.98
R6321:Ltbp3 UTSW 19 5,795,685 (GRCm39) missense probably benign 0.09
R6339:Ltbp3 UTSW 19 5,797,505 (GRCm39) missense probably damaging 1.00
R6371:Ltbp3 UTSW 19 5,795,800 (GRCm39) splice site probably null
R6709:Ltbp3 UTSW 19 5,797,885 (GRCm39) critical splice donor site probably null
R7666:Ltbp3 UTSW 19 5,797,034 (GRCm39) missense possibly damaging 0.79
R8499:Ltbp3 UTSW 19 5,798,712 (GRCm39) missense probably benign 0.01
R8937:Ltbp3 UTSW 19 5,797,512 (GRCm39) missense probably benign 0.09
R9362:Ltbp3 UTSW 19 5,803,697 (GRCm39) missense probably benign 0.01
R9645:Ltbp3 UTSW 19 5,802,099 (GRCm39) missense probably damaging 1.00
R9697:Ltbp3 UTSW 19 5,792,521 (GRCm39) missense probably benign 0.00
R9774:Ltbp3 UTSW 19 5,804,014 (GRCm39) missense probably benign 0.08
X0066:Ltbp3 UTSW 19 5,801,305 (GRCm39) missense probably benign 0.01
Z1177:Ltbp3 UTSW 19 5,797,758 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTGAGAGCAATTCATTCTGGGAC -3'
(R):5'- TGGTTCAGTTCTCGGCACTC -3'

Sequencing Primer
(F):5'- GCAATTCATTCTGGGACACAAG -3'
(R):5'- CACTCATCAATGTCTGCAAGGTGG -3'
Posted On 2019-06-07