Incidental Mutation 'PIT4445001:Cd247'
ID555372
Institutional Source Beutler Lab
Gene Symbol Cd247
Ensembl Gene ENSMUSG00000005763
Gene NameCD247 antigen
SynonymsCD3-zeta, CD3 zeta, Tcrz, T3z, Cd3h, TCRk, CD3-zeta/eta, Cd3z, CD3zeta, 4930549J05Rik, CD3-eta
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #PIT4445001 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location165788681-165877277 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 165861036 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 154 (D154E)
Ref Sequence ENSEMBL: ENSMUSP00000005907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005907] [ENSMUST00000027849] [ENSMUST00000086002] [ENSMUST00000111427] [ENSMUST00000160260] [ENSMUST00000161559] [ENSMUST00000161971] [ENSMUST00000178336] [ENSMUST00000187313]
Predicted Effect probably damaging
Transcript: ENSMUST00000005907
AA Change: D154E

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000005907
Gene: ENSMUSG00000005763
AA Change: D154E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:TCR_zetazeta 28 60 1.7e-23 PFAM
ITAM 69 89 6.91e-5 SMART
ITAM 108 129 1.27e-3 SMART
ITAM 139 159 6.45e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000027849
SMART Domains Protein: ENSMUSP00000027849
Gene: ENSMUSG00000005763

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:TCR_zetazeta 28 58 4.3e-21 PFAM
ITAM 69 89 6.91e-5 SMART
ITAM 108 129 1.27e-3 SMART
low complexity region 195 204 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086002
SMART Domains Protein: ENSMUSP00000083165
Gene: ENSMUSG00000005763

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:TCR_zetazeta 28 60 2.5e-23 PFAM
ITAM 69 89 6.91e-5 SMART
ITAM 108 129 1.27e-3 SMART
low complexity region 195 204 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111427
SMART Domains Protein: ENSMUSP00000107056
Gene: ENSMUSG00000026565

DomainStartEndE-ValueType
low complexity region 83 112 N/A INTRINSIC
low complexity region 130 172 N/A INTRINSIC
low complexity region 189 204 N/A INTRINSIC
low complexity region 223 244 N/A INTRINSIC
low complexity region 251 269 N/A INTRINSIC
POU 293 367 1.55e-52 SMART
low complexity region 368 384 N/A INTRINSIC
HOX 394 456 2.54e-19 SMART
low complexity region 474 500 N/A INTRINSIC
low complexity region 531 596 N/A INTRINSIC
low complexity region 605 643 N/A INTRINSIC
low complexity region 751 761 N/A INTRINSIC
low complexity region 764 781 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160260
SMART Domains Protein: ENSMUSP00000124738
Gene: ENSMUSG00000026565

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 94 123 N/A INTRINSIC
low complexity region 141 183 N/A INTRINSIC
low complexity region 200 215 N/A INTRINSIC
low complexity region 234 255 N/A INTRINSIC
low complexity region 262 280 N/A INTRINSIC
POU 304 378 1.55e-52 SMART
low complexity region 379 395 N/A INTRINSIC
HOX 405 467 2.54e-19 SMART
low complexity region 485 511 N/A INTRINSIC
low complexity region 542 607 N/A INTRINSIC
low complexity region 616 654 N/A INTRINSIC
low complexity region 762 772 N/A INTRINSIC
low complexity region 775 792 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161559
SMART Domains Protein: ENSMUSP00000124299
Gene: ENSMUSG00000005763

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:TCR_zetazeta 28 60 1.7e-24 PFAM
ITAM 69 89 6.91e-5 SMART
ITAM 107 128 1.27e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161971
SMART Domains Protein: ENSMUSP00000124297
Gene: ENSMUSG00000005763

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:TCR_zetazeta 28 60 1.5e-23 PFAM
ITAM 69 89 6.91e-5 SMART
ITAM 108 129 1.27e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178336
SMART Domains Protein: ENSMUSP00000136456
Gene: ENSMUSG00000005763

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:TCR_zetazeta 28 60 1.7e-23 PFAM
ITAM 69 89 6.91e-5 SMART
ITAM 108 129 1.27e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187313
SMART Domains Protein: ENSMUSP00000140926
Gene: ENSMUSG00000005763

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:TCR_zetazeta 28 60 2.5e-23 PFAM
ITAM 69 89 6.91e-5 SMART
ITAM 108 129 1.27e-3 SMART
low complexity region 195 204 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 90.8%
  • 10x: 84.5%
  • 20x: 70.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is T-cell receptor zeta, which together with T-cell receptor alpha/beta and gamma/delta heterodimers, and with CD3-gamma, -delta and -epsilon, forms the T-cell receptor-CD3 complex. The zeta chain plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. Low expression of the antigen results in impaired immune response. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit greatly reduced numbers of CD4+CD8+ cells, and near absence of CD4+CD8-, CD4-CD8+ cells, and TCR expression in the thymus, but the presence of single positive T cells in lymph nodes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,075,551 K419E probably damaging Het
Adam7 T A 14: 68,509,748 K587N possibly damaging Het
Agl T C 3: 116,771,460 M382V Het
Agpat3 A T 10: 78,274,093 F341I possibly damaging Het
Ampd2 A T 3: 108,075,012 L767Q probably damaging Het
Arhgap28 A T 17: 67,896,235 D124E possibly damaging Het
Arhgap32 T C 9: 32,260,856 L1644P probably damaging Het
Asic4 T C 1: 75,451,127 V99A probably benign Het
Asns T A 6: 7,689,277 N75I probably damaging Het
Atp10a A G 7: 58,803,467 D798G probably damaging Het
Atp8a1 A G 5: 67,622,660 V1145A Het
BC017158 A G 7: 128,276,534 V243A probably benign Het
Ccdc171 A G 4: 83,661,747 Q577R probably damaging Het
Ceacam1 A T 7: 25,476,456 N104K probably damaging Het
Chfr A G 5: 110,151,677 D312G possibly damaging Het
Ddb1 C A 19: 10,625,970 L881I probably damaging Het
Dgkh A T 14: 78,575,942 I1032N possibly damaging Het
Efcab6 A T 15: 83,904,267 V942D probably benign Het
Fmo5 A G 3: 97,651,528 T435A probably benign Het
Fpr1 T C 17: 17,876,893 Q278R probably benign Het
Fzr1 C T 10: 81,369,394 W256* probably null Het
Gabrb1 T C 5: 72,108,782 S261P probably damaging Het
Galr2 G T 11: 116,281,648 A55S probably benign Het
Gbp2 A T 3: 142,637,466 K581N probably benign Het
Gm7682 T G 5: 94,448,507 W468G probably benign Het
Gria1 A T 11: 57,185,838 Y89F probably damaging Het
Ibsp T A 5: 104,302,304 I26N possibly damaging Het
Igf1r T C 7: 68,207,463 F1058L probably damaging Het
Ighv1-16 A C 12: 114,666,060 C36G probably benign Het
Igll1 T C 16: 16,860,919 T176A probably benign Het
Ilkap T C 1: 91,385,345 T143A probably benign Het
Kdm3b A T 18: 34,793,115 K103* probably null Het
Mphosph9 A G 5: 124,298,790 I497T possibly damaging Het
Mrgpra3 G A 7: 47,590,160 T6I possibly damaging Het
Mrpl38 T C 11: 116,132,558 probably null Het
Myo3a A T 2: 22,542,415 E813V possibly damaging Het
Myo7b G T 18: 31,959,466 Q2093K possibly damaging Het
Myo7b T C 18: 31,962,352 K1851R probably damaging Het
P3h2 T A 16: 25,984,999 D339V probably benign Het
Pcdhb6 C A 18: 37,335,247 P407Q possibly damaging Het
Plch2 C A 4: 155,009,026 R153L probably damaging Het
Plppr4 G A 3: 117,360,308 probably benign Het
Ppp1r3a A G 6: 14,717,777 F1046S probably damaging Het
Prkacb A T 3: 146,755,691 L107M probably benign Het
Ranbp17 A G 11: 33,481,020 probably null Het
Rasl11b C A 5: 74,197,333 P88Q probably damaging Het
Rcc2 A G 4: 140,721,149 E503G possibly damaging Het
Rnf216 T A 5: 143,086,003 K407N probably damaging Het
Scrn3 G A 2: 73,318,329 M81I possibly damaging Het
Scube2 T C 7: 109,809,180 T687A probably benign Het
Serpinb10 T A 1: 107,535,998 F3L probably benign Het
Sgcb C T 5: 73,639,812 V202I probably damaging Het
Sgce A G 6: 4,689,654 V429A possibly damaging Het
Sh3rf2 T C 18: 42,153,164 V574A probably benign Het
Sncaip T C 18: 52,868,944 L179S probably damaging Het
Sntg2 A T 12: 30,312,572 D58E probably damaging Het
Taar3 T C 10: 23,949,688 I44T possibly damaging Het
Tmem87b G A 2: 128,831,471 V227I probably benign Het
Tnfsf9 T C 17: 57,105,517 L29P possibly damaging Het
Tnip2 T C 5: 34,496,871 H391R probably benign Het
Traf5 A G 1: 191,997,807 Y125H Het
Ttc23 T G 7: 67,667,213 I77M probably damaging Het
Ube2l3 T C 16: 17,160,172 N43S probably benign Het
Vars2 A T 17: 35,666,211 C142* probably null Het
Vmn2r15 A C 5: 109,287,142 D565E probably damaging Het
Vmn2r56 C T 7: 12,715,226 probably null Het
Vmn2r79 A T 7: 87,002,200 D269V possibly damaging Het
Vmn2r85 A T 10: 130,425,703 M255K probably benign Het
Wfdc6a T A 2: 164,579,826 *137C probably null Het
Wipi2 T C 5: 142,666,884 V417A probably benign Het
Xirp2 G T 2: 67,509,772 V786L possibly damaging Het
Zdhhc13 G A 7: 48,795,949 G26S probably benign Het
Zscan25 T A 5: 145,290,612 V362D probably damaging Het
Other mutations in Cd247
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02869:Cd247 APN 1 165857417 missense probably damaging 1.00
allia UTSW 1 165855214 missense probably damaging 1.00
R1114:Cd247 UTSW 1 165788838 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TGTCAGCATTCTCAGGCAAG -3'
(R):5'- CCCTTTAGAGAGTCCAGGGATG -3'

Sequencing Primer
(F):5'- GTCAGCATTCTCAGGCAAGATTCC -3'
(R):5'- CTTTAGAGAGTCCAGGGATGACGTTC -3'
Posted On2019-06-07