Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4445001:Myo3a'

555374

Institutional Source

Beutler Lab

Gene Symbol

Myo3a

Ensembl Gene

ENSMUSG00000025716

Gene Name

myosin IIIA

Synonyms

9030416P08Rik

Accession Numbers

Genbank: NM_148413; MGI: 2183924

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

PIT4445001 (G1)

Quality Score

202.009

Status

Not validated

Chromosome

Chromosomal Location

22227503-22618252 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 22542415 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Valine at position 813 (E813V)

Ref Sequence

ENSEMBL: ENSMUSP00000046329 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044749]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000044749
AA Change: E813V

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000046329
Gene: ENSMUSG00000025716
AA Change: E813V

Domain	Start	End	E-Value	Type
S_TKc	29	295	1.62e-91	SMART
MYSc	340	1061	2.07e-252	SMART
IQ	1061	1083	2.88e1	SMART
IQ	1088	1110	9.48e-3	SMART
low complexity region	1153	1169	N/A	INTRINSIC
low complexity region	1359	1369	N/A	INTRINSIC
low complexity region	1496	1505	N/A	INTRINSIC

Coding Region Coverage

1x: 93.5%
3x: 90.8%
10x: 84.5%
20x: 70.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the myosin superfamily. Myosins are actin-dependent motor proteins and are categorized into conventional myosins (class II) and unconventional myosins (classes I and III through XV) based on their variable C-terminal cargo-binding domains. Class III myosins, such as this one, have a kinase domain N-terminal to the conserved N-terminal motor domains and are expressed in photoreceptors. The protein encoded by this gene plays an important role in hearing in humans. Three different recessive, loss of function mutations in the encoded protein have been shown to cause nonsyndromic progressive hearing loss. Expression of this gene is highly restricted, with the strongest expression in retina and cochlea. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired hearing and cochlear hair cell degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8a	T	C	11: 110,075,551	K419E	probably damaging	Het
Adam7	T	A	14: 68,509,748	K587N	possibly damaging	Het
Agl	T	C	3: 116,771,460	M382V		Het
Agpat3	A	T	10: 78,274,093	F341I	possibly damaging	Het
Ampd2	A	T	3: 108,075,012	L767Q	probably damaging	Het
Arhgap28	A	T	17: 67,896,235	D124E	possibly damaging	Het
Arhgap32	T	C	9: 32,260,856	L1644P	probably damaging	Het
Asic4	T	C	1: 75,451,127	V99A	probably benign	Het
Asns	T	A	6: 7,689,277	N75I	probably damaging	Het
Atp10a	A	G	7: 58,803,467	D798G	probably damaging	Het
Atp8a1	A	G	5: 67,622,660	V1145A		Het
BC017158	A	G	7: 128,276,534	V243A	probably benign	Het
Ccdc171	A	G	4: 83,661,747	Q577R	probably damaging	Het
Cd247	T	A	1: 165,861,036	D154E	probably damaging	Het
Ceacam1	A	T	7: 25,476,456	N104K	probably damaging	Het
Chfr	A	G	5: 110,151,677	D312G	possibly damaging	Het
Ddb1	C	A	19: 10,625,970	L881I	probably damaging	Het
Dgkh	A	T	14: 78,575,942	I1032N	possibly damaging	Het
Efcab6	A	T	15: 83,904,267	V942D	probably benign	Het
Fmo5	A	G	3: 97,651,528	T435A	probably benign	Het
Fpr1	T	C	17: 17,876,893	Q278R	probably benign	Het
Fzr1	C	T	10: 81,369,394	W256*	probably null	Het
Gabrb1	T	C	5: 72,108,782	S261P	probably damaging	Het
Galr2	G	T	11: 116,281,648	A55S	probably benign	Het
Gbp2	A	T	3: 142,637,466	K581N	probably benign	Het
Gm7682	T	G	5: 94,448,507	W468G	probably benign	Het
Gria1	A	T	11: 57,185,838	Y89F	probably damaging	Het
Ibsp	T	A	5: 104,302,304	I26N	possibly damaging	Het
Igf1r	T	C	7: 68,207,463	F1058L	probably damaging	Het
Ighv1-16	A	C	12: 114,666,060	C36G	probably benign	Het
Igll1	T	C	16: 16,860,919	T176A	probably benign	Het
Ilkap	T	C	1: 91,385,345	T143A	probably benign	Het
Kdm3b	A	T	18: 34,793,115	K103*	probably null	Het
Mphosph9	A	G	5: 124,298,790	I497T	possibly damaging	Het
Mrgpra3	G	A	7: 47,590,160	T6I	possibly damaging	Het
Mrpl38	T	C	11: 116,132,558		probably null	Het
Myo7b	G	T	18: 31,959,466	Q2093K	possibly damaging	Het
Myo7b	T	C	18: 31,962,352	K1851R	probably damaging	Het
P3h2	T	A	16: 25,984,999	D339V	probably benign	Het
Pcdhb6	C	A	18: 37,335,247	P407Q	possibly damaging	Het
Plch2	C	A	4: 155,009,026	R153L	probably damaging	Het
Plppr4	G	A	3: 117,360,308		probably benign	Het
Ppp1r3a	A	G	6: 14,717,777	F1046S	probably damaging	Het
Prkacb	A	T	3: 146,755,691	L107M	probably benign	Het
Ranbp17	A	G	11: 33,481,020		probably null	Het
Rasl11b	C	A	5: 74,197,333	P88Q	probably damaging	Het
Rcc2	A	G	4: 140,721,149	E503G	possibly damaging	Het
Rnf216	T	A	5: 143,086,003	K407N	probably damaging	Het
Scrn3	G	A	2: 73,318,329	M81I	possibly damaging	Het
Scube2	T	C	7: 109,809,180	T687A	probably benign	Het
Serpinb10	T	A	1: 107,535,998	F3L	probably benign	Het
Sgcb	C	T	5: 73,639,812	V202I	probably damaging	Het
Sgce	A	G	6: 4,689,654	V429A	possibly damaging	Het
Sh3rf2	T	C	18: 42,153,164	V574A	probably benign	Het
Sncaip	T	C	18: 52,868,944	L179S	probably damaging	Het
Sntg2	A	T	12: 30,312,572	D58E	probably damaging	Het
Taar3	T	C	10: 23,949,688	I44T	possibly damaging	Het
Tmem87b	G	A	2: 128,831,471	V227I	probably benign	Het
Tnfsf9	T	C	17: 57,105,517	L29P	possibly damaging	Het
Tnip2	T	C	5: 34,496,871	H391R	probably benign	Het
Traf5	A	G	1: 191,997,807	Y125H		Het
Ttc23	T	G	7: 67,667,213	I77M	probably damaging	Het
Ube2l3	T	C	16: 17,160,172	N43S	probably benign	Het
Vars2	A	T	17: 35,666,211	C142*	probably null	Het
Vmn2r15	A	C	5: 109,287,142	D565E	probably damaging	Het
Vmn2r56	C	T	7: 12,715,226		probably null	Het
Vmn2r79	A	T	7: 87,002,200	D269V	possibly damaging	Het
Vmn2r85	A	T	10: 130,425,703	M255K	probably benign	Het
Wfdc6a	T	A	2: 164,579,826	*137C	probably null	Het
Wipi2	T	C	5: 142,666,884	V417A	probably benign	Het
Xirp2	G	T	2: 67,509,772	V786L	possibly damaging	Het
Zdhhc13	G	A	7: 48,795,949	G26S	probably benign	Het
Zscan25	T	A	5: 145,290,612	V362D	probably damaging	Het

Other mutations in Myo3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01014:Myo3a	APN	2	22332473	missense	probably benign	0.42
IGL01307:Myo3a	APN	2	22558289	missense	probably damaging	1.00
IGL01413:Myo3a	APN	2	22297600	missense	probably benign	0.25
IGL01655:Myo3a	APN	2	22423326	missense	probably damaging	1.00
IGL01767:Myo3a	APN	2	22423222	missense	probably damaging	0.96
IGL01803:Myo3a	APN	2	22241115	missense	probably damaging	1.00
IGL01969:Myo3a	APN	2	22297688	missense	probably benign	0.03
IGL02043:Myo3a	APN	2	22399965	missense	probably benign	0.01
IGL02124:Myo3a	APN	2	22577526	missense	probably benign	0.01
IGL02174:Myo3a	APN	2	22332393	missense	probably benign	0.04
IGL02649:Myo3a	APN	2	22323607	missense	probably benign
IGL02976:Myo3a	APN	2	22542452	nonsense	probably null
IGL03328:Myo3a	APN	2	22578198	missense	probably benign	0.02
IGL03376:Myo3a	APN	2	22600074	splice site	probably benign
lose	UTSW	2	22558320	nonsense	probably null
snooze	UTSW	2	22282634	missense	probably damaging	0.99
A5278:Myo3a	UTSW	2	22323653	missense	probably benign	0.27
R0008:Myo3a	UTSW	2	22579741	missense	probably damaging	0.99
R0099:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0103:Myo3a	UTSW	2	22544322	splice site	probably benign
R0103:Myo3a	UTSW	2	22544322	splice site	probably benign
R0212:Myo3a	UTSW	2	22291848	missense	probably damaging	1.00
R0281:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0282:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0492:Myo3a	UTSW	2	22323636	missense	possibly damaging	0.46
R0498:Myo3a	UTSW	2	22577429	missense	possibly damaging	0.74
R0594:Myo3a	UTSW	2	22544332	splice site	probably benign
R0609:Myo3a	UTSW	2	22333513	missense	probably benign	0.29
R0609:Myo3a	UTSW	2	22396299	missense	possibly damaging	0.95
R0827:Myo3a	UTSW	2	22558215	missense	probably damaging	1.00
R0968:Myo3a	UTSW	2	22558289	missense	probably damaging	1.00
R1157:Myo3a	UTSW	2	22542414	critical splice acceptor site	probably null
R1301:Myo3a	UTSW	2	22267095	splice site	probably benign
R1352:Myo3a	UTSW	2	22323675	critical splice donor site	probably null
R1443:Myo3a	UTSW	2	22282626	missense	probably damaging	0.99
R1465:Myo3a	UTSW	2	22577927	missense	probably benign	0.00
R1465:Myo3a	UTSW	2	22577927	missense	probably benign	0.00
R1517:Myo3a	UTSW	2	22282634	missense	probably damaging	0.99
R1565:Myo3a	UTSW	2	22340280	missense	probably damaging	1.00
R1712:Myo3a	UTSW	2	22564992	missense	probably damaging	1.00
R1722:Myo3a	UTSW	2	22399827	missense	probably benign	0.03
R1822:Myo3a	UTSW	2	22340280	missense	probably damaging	1.00
R1823:Myo3a	UTSW	2	22340280	missense	probably damaging	1.00
R1824:Myo3a	UTSW	2	22396243	missense	probably benign
R1837:Myo3a	UTSW	2	22577592	missense	possibly damaging	0.76
R1867:Myo3a	UTSW	2	22399846	missense	probably benign	0.00
R1917:Myo3a	UTSW	2	22291922	missense	probably damaging	1.00
R1920:Myo3a	UTSW	2	22564996	missense	probably benign	0.02
R1937:Myo3a	UTSW	2	22396315	missense	probably damaging	1.00
R1954:Myo3a	UTSW	2	22241226	missense	probably damaging	1.00
R1988:Myo3a	UTSW	2	22578128	missense	possibly damaging	0.86
R2091:Myo3a	UTSW	2	22333677	missense	probably damaging	0.99
R2115:Myo3a	UTSW	2	22245531	missense	probably damaging	1.00
R2125:Myo3a	UTSW	2	22578174	missense	probably benign	0.42
R2126:Myo3a	UTSW	2	22578174	missense	probably benign	0.42
R2216:Myo3a	UTSW	2	22577771	missense	probably benign	0.00
R2413:Myo3a	UTSW	2	22577912	missense	probably benign	0.00
R2964:Myo3a	UTSW	2	22340256	missense	possibly damaging	0.90
R3196:Myo3a	UTSW	2	22399868	missense	possibly damaging	0.86
R3837:Myo3a	UTSW	2	22565109	splice site	probably benign
R3905:Myo3a	UTSW	2	22558215	missense	probably damaging	1.00
R3926:Myo3a	UTSW	2	22565041	missense	probably damaging	0.99
R4014:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4015:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4017:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4043:Myo3a	UTSW	2	22333539	splice site	probably benign
R4044:Myo3a	UTSW	2	22577700	missense	probably damaging	0.99
R4057:Myo3a	UTSW	2	22266160	missense	probably benign	0.01
R4192:Myo3a	UTSW	2	22407377	missense	probably damaging	1.00
R4282:Myo3a	UTSW	2	22340278	missense	probably benign	0.14
R4321:Myo3a	UTSW	2	22267155	missense	probably damaging	1.00
R4393:Myo3a	UTSW	2	22577854	missense	probably damaging	0.99
R4398:Myo3a	UTSW	2	22577842	missense	probably benign
R4446:Myo3a	UTSW	2	22600137	missense	probably damaging	1.00
R4685:Myo3a	UTSW	2	22407422	missense	probably damaging	1.00
R5032:Myo3a	UTSW	2	22282602	missense	probably damaging	1.00
R5096:Myo3a	UTSW	2	22574242	missense	probably benign	0.16
R5183:Myo3a	UTSW	2	22578158	missense	probably benign	0.05
R5458:Myo3a	UTSW	2	22245550	missense	probably damaging	1.00
R5502:Myo3a	UTSW	2	22558369	missense	probably damaging	1.00
R5522:Myo3a	UTSW	2	22574341	missense	probably damaging	1.00
R6462:Myo3a	UTSW	2	22558411	missense	probably damaging	1.00
R6479:Myo3a	UTSW	2	22577865	missense	probably benign	0.00
R6513:Myo3a	UTSW	2	22407332	missense	probably damaging	1.00
R6520:Myo3a	UTSW	2	22399926	missense	possibly damaging	0.90
R6602:Myo3a	UTSW	2	22577787	missense	probably damaging	0.96
R6671:Myo3a	UTSW	2	22294522	missense	probably damaging	1.00
R6743:Myo3a	UTSW	2	22361664	missense	probably benign	0.24
R6865:Myo3a	UTSW	2	22574301	missense	probably benign	0.00
R6961:Myo3a	UTSW	2	22245558	missense	probably benign	0.00
R7001:Myo3a	UTSW	2	22332377	missense	probably benign	0.04
R7215:Myo3a	UTSW	2	22245567	missense	possibly damaging	0.78
R7301:Myo3a	UTSW	2	22544466	critical splice donor site	probably null
R7318:Myo3a	UTSW	2	22558320	nonsense	probably null
R7447:Myo3a	UTSW	2	22544426	missense	probably benign	0.27
R7456:Myo3a	UTSW	2	22407444	missense	probably benign	0.08
R7528:Myo3a	UTSW	2	22266114	nonsense	probably null
R7731:Myo3a	UTSW	2	22282589	missense	probably damaging	1.00
R7768:Myo3a	UTSW	2	22241143	missense	probably damaging	0.99
R8054:Myo3a	UTSW	2	22574317	missense	probably benign	0.00
R8140:Myo3a	UTSW	2	22407346	missense	probably damaging	1.00
R8143:Myo3a	UTSW	2	22282665	critical splice donor site	probably null
R8346:Myo3a	UTSW	2	22558422	critical splice donor site	probably null
R8421:Myo3a	UTSW	2	22362124	missense	probably benign	0.07
R8495:Myo3a	UTSW	2	22396273	missense	probably damaging	0.96
R8551:Myo3a	UTSW	2	22332466	missense	probably benign	0.00
R8708:Myo3a	UTSW	2	22291796	splice site	probably benign
R8757:Myo3a	UTSW	2	22558307	missense	possibly damaging	0.49
R8759:Myo3a	UTSW	2	22558307	missense	possibly damaging	0.49
R8779:Myo3a	UTSW	2	22245593	nonsense	probably null
R8828:Myo3a	UTSW	2	22241053	missense	probably benign	0.01
R8910:Myo3a	UTSW	2	22574268	missense	probably benign	0.01
R8916:Myo3a	UTSW	2	22567692	missense	probably damaging	1.00
R8926:Myo3a	UTSW	2	22396263	missense	possibly damaging	0.95
R9028:Myo3a	UTSW	2	22600087	missense	possibly damaging	0.79
R9046:Myo3a	UTSW	2	22558355	missense	probably damaging	0.99
R9120:Myo3a	UTSW	2	22544426	missense	probably benign	0.27
R9153:Myo3a	UTSW	2	22399933	missense	probably benign	0.02
R9191:Myo3a	UTSW	2	22579829	missense	probably benign	0.24
R9258:Myo3a	UTSW	2	22577533	missense	possibly damaging	0.60
R9436:Myo3a	UTSW	2	22407424	nonsense	probably null
R9464:Myo3a	UTSW	2	22227572	start gained	probably benign
R9487:Myo3a	UTSW	2	22241051	missense	probably benign
R9719:Myo3a	UTSW	2	22544455	missense	probably benign	0.02
R9799:Myo3a	UTSW	2	22600169	missense	probably damaging	1.00
Z1177:Myo3a	UTSW	2	22618140	missense	possibly damaging	0.58

Predicted Primers

PCR Primer
(F):5'- TCAGGGCTTCAGGGTCAGAG -3'
(R):5'- CAGATAGAGACAAGATATTTTCACCTC -3'

Sequencing Primer
(F):5'- TGAGACCTACCAAGTGTTGC -3'
(R):5'- TTCACCTCAATTAGAACCATCTTTC -3'

Posted On

2019-06-07