Incidental Mutation 'PIT4445001:Fmo5'
ID555379
Institutional Source Beutler Lab
Gene Symbol Fmo5
Ensembl Gene ENSMUSG00000028088
Gene Nameflavin containing monooxygenase 5
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #PIT4445001 (G1)
Quality Score223.009
Status Not validated
Chromosome3
Chromosomal Location97628804-97655282 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97651528 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 435 (T435A)
Ref Sequence ENSEMBL: ENSMUSP00000029729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029729] [ENSMUST00000107049] [ENSMUST00000107050]
Predicted Effect probably benign
Transcript: ENSMUST00000029729
AA Change: T435A

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000029729
Gene: ENSMUSG00000028088
AA Change: T435A

DomainStartEndE-ValueType
Pfam:FMO-like 3 533 9.7e-280 PFAM
Pfam:Pyr_redox_2 5 224 3.4e-8 PFAM
Pfam:Pyr_redox_3 7 221 2.2e-21 PFAM
Pfam:NAD_binding_8 8 69 1.7e-6 PFAM
Pfam:K_oxygenase 81 223 9.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107049
AA Change: T435A

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000102664
Gene: ENSMUSG00000028088
AA Change: T435A

DomainStartEndE-ValueType
Pfam:FMO-like 3 533 9.7e-280 PFAM
Pfam:Pyr_redox_2 5 224 3.4e-8 PFAM
Pfam:Pyr_redox_3 7 221 2.2e-21 PFAM
Pfam:NAD_binding_8 8 69 1.7e-6 PFAM
Pfam:K_oxygenase 81 223 9.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107050
AA Change: T435A

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000102665
Gene: ENSMUSG00000028088
AA Change: T435A

DomainStartEndE-ValueType
Pfam:FMO-like 3 533 9.7e-280 PFAM
Pfam:Pyr_redox_2 4 228 8.5e-11 PFAM
Pfam:Pyr_redox_3 7 221 4.7e-11 PFAM
Pfam:NAD_binding_8 8 70 3.5e-7 PFAM
Pfam:K_oxygenase 80 222 2.9e-8 PFAM
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 90.8%
  • 10x: 84.5%
  • 20x: 70.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Metabolic N-oxidation of the diet-derived amino-trimethylamine (TMA) is mediated by flavin-containing monooxygenase and is subject to an inherited FMO3 polymorphism in man resulting in a small subpopulation with reduced TMA N-oxidation capacity resulting in fish odor syndrome Trimethylaminuria. Three forms of the enzyme, FMO1 found in fetal liver, FMO2 found in adult liver, and FMO3 are encoded by genes clustered in the 1q23-q25 region. Flavin-containing monooxygenases are NADPH-dependent flavoenzymes that catalyzes the oxidation of soft nucleophilic heteroatom centers in drugs, pesticides, and xenobiotics. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a knock-out allele show an age-related lean phenotype despite increased food intake, lower plasma levels of glucose and cholesterol, decreased fat storage in WAT, altered fatty acid oxidation, increased energy expenditure and respiratory quotient but normal physical activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,075,551 K419E probably damaging Het
Adam7 T A 14: 68,509,748 K587N possibly damaging Het
Agl T C 3: 116,771,460 M382V Het
Agpat3 A T 10: 78,274,093 F341I possibly damaging Het
Ampd2 A T 3: 108,075,012 L767Q probably damaging Het
Arhgap28 A T 17: 67,896,235 D124E possibly damaging Het
Arhgap32 T C 9: 32,260,856 L1644P probably damaging Het
Asic4 T C 1: 75,451,127 V99A probably benign Het
Asns T A 6: 7,689,277 N75I probably damaging Het
Atp10a A G 7: 58,803,467 D798G probably damaging Het
Atp8a1 A G 5: 67,622,660 V1145A Het
BC017158 A G 7: 128,276,534 V243A probably benign Het
Ccdc171 A G 4: 83,661,747 Q577R probably damaging Het
Cd247 T A 1: 165,861,036 D154E probably damaging Het
Ceacam1 A T 7: 25,476,456 N104K probably damaging Het
Chfr A G 5: 110,151,677 D312G possibly damaging Het
Ddb1 C A 19: 10,625,970 L881I probably damaging Het
Dgkh A T 14: 78,575,942 I1032N possibly damaging Het
Efcab6 A T 15: 83,904,267 V942D probably benign Het
Fpr1 T C 17: 17,876,893 Q278R probably benign Het
Fzr1 C T 10: 81,369,394 W256* probably null Het
Gabrb1 T C 5: 72,108,782 S261P probably damaging Het
Galr2 G T 11: 116,281,648 A55S probably benign Het
Gbp2 A T 3: 142,637,466 K581N probably benign Het
Gm7682 T G 5: 94,448,507 W468G probably benign Het
Gria1 A T 11: 57,185,838 Y89F probably damaging Het
Ibsp T A 5: 104,302,304 I26N possibly damaging Het
Igf1r T C 7: 68,207,463 F1058L probably damaging Het
Ighv1-16 A C 12: 114,666,060 C36G probably benign Het
Igll1 T C 16: 16,860,919 T176A probably benign Het
Ilkap T C 1: 91,385,345 T143A probably benign Het
Kdm3b A T 18: 34,793,115 K103* probably null Het
Mphosph9 A G 5: 124,298,790 I497T possibly damaging Het
Mrgpra3 G A 7: 47,590,160 T6I possibly damaging Het
Mrpl38 T C 11: 116,132,558 probably null Het
Myo3a A T 2: 22,542,415 E813V possibly damaging Het
Myo7b G T 18: 31,959,466 Q2093K possibly damaging Het
Myo7b T C 18: 31,962,352 K1851R probably damaging Het
P3h2 T A 16: 25,984,999 D339V probably benign Het
Pcdhb6 C A 18: 37,335,247 P407Q possibly damaging Het
Plch2 C A 4: 155,009,026 R153L probably damaging Het
Plppr4 G A 3: 117,360,308 probably benign Het
Ppp1r3a A G 6: 14,717,777 F1046S probably damaging Het
Prkacb A T 3: 146,755,691 L107M probably benign Het
Ranbp17 A G 11: 33,481,020 probably null Het
Rasl11b C A 5: 74,197,333 P88Q probably damaging Het
Rcc2 A G 4: 140,721,149 E503G possibly damaging Het
Rnf216 T A 5: 143,086,003 K407N probably damaging Het
Scrn3 G A 2: 73,318,329 M81I possibly damaging Het
Scube2 T C 7: 109,809,180 T687A probably benign Het
Serpinb10 T A 1: 107,535,998 F3L probably benign Het
Sgcb C T 5: 73,639,812 V202I probably damaging Het
Sgce A G 6: 4,689,654 V429A possibly damaging Het
Sh3rf2 T C 18: 42,153,164 V574A probably benign Het
Sncaip T C 18: 52,868,944 L179S probably damaging Het
Sntg2 A T 12: 30,312,572 D58E probably damaging Het
Taar3 T C 10: 23,949,688 I44T possibly damaging Het
Tmem87b G A 2: 128,831,471 V227I probably benign Het
Tnfsf9 T C 17: 57,105,517 L29P possibly damaging Het
Tnip2 T C 5: 34,496,871 H391R probably benign Het
Traf5 A G 1: 191,997,807 Y125H Het
Ttc23 T G 7: 67,667,213 I77M probably damaging Het
Ube2l3 T C 16: 17,160,172 N43S probably benign Het
Vars2 A T 17: 35,666,211 C142* probably null Het
Vmn2r15 A C 5: 109,287,142 D565E probably damaging Het
Vmn2r56 C T 7: 12,715,226 probably null Het
Vmn2r79 A T 7: 87,002,200 D269V possibly damaging Het
Vmn2r85 A T 10: 130,425,703 M255K probably benign Het
Wfdc6a T A 2: 164,579,826 *137C probably null Het
Wipi2 T C 5: 142,666,884 V417A probably benign Het
Xirp2 G T 2: 67,509,772 V786L possibly damaging Het
Zdhhc13 G A 7: 48,795,949 G26S probably benign Het
Zscan25 T A 5: 145,290,612 V362D probably damaging Het
Other mutations in Fmo5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01469:Fmo5 APN 3 97651568 missense probably benign 0.19
IGL01926:Fmo5 APN 3 97637481 missense probably damaging 1.00
IGL03062:Fmo5 APN 3 97635593 missense probably damaging 1.00
IGL03215:Fmo5 APN 3 97641806 missense probably benign
IGL03323:Fmo5 APN 3 97639007 splice site probably null
R0133:Fmo5 UTSW 3 97645636 missense probably damaging 0.99
R0207:Fmo5 UTSW 3 97645681 missense probably damaging 1.00
R0570:Fmo5 UTSW 3 97629140 missense probably damaging 1.00
R2014:Fmo5 UTSW 3 97635682 missense possibly damaging 0.56
R2093:Fmo5 UTSW 3 97645878 missense probably benign 0.41
R3087:Fmo5 UTSW 3 97641695 missense probably damaging 1.00
R3694:Fmo5 UTSW 3 97645914 missense probably damaging 1.00
R3764:Fmo5 UTSW 3 97645717 missense probably damaging 1.00
R4864:Fmo5 UTSW 3 97645879 missense probably damaging 1.00
R4987:Fmo5 UTSW 3 97635578 missense probably benign 0.23
R5152:Fmo5 UTSW 3 97641762 missense probably benign 0.00
R5304:Fmo5 UTSW 3 97651622 missense probably damaging 1.00
R5306:Fmo5 UTSW 3 97641760 missense probably benign 0.00
R5563:Fmo5 UTSW 3 97638891 missense probably damaging 1.00
R5888:Fmo5 UTSW 3 97641725 missense probably benign 0.10
R6352:Fmo5 UTSW 3 97645675 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GCTGCATCTTAAGGTCCGTAAG -3'
(R):5'- GCTTCCGAACACGATCTTCC -3'

Sequencing Primer
(F):5'- AGGAAGGTGATAAATGTCCTAACTC -3'
(R):5'- ACGATCTTCCGTGGTGAGAATAG -3'
Posted On2019-06-07