Incidental Mutation 'R0603:Ttc39a'
ID55538
Institutional Source Beutler Lab
Gene Symbol Ttc39a
Ensembl Gene ENSMUSG00000028555
Gene Nametetratricopeptide repeat domain 39A
Synonyms4922503N01Rik
MMRRC Submission 038792-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0603 (G1)
Quality Score193
Status Not validated
Chromosome4
Chromosomal Location109406623-109444745 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109426302 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 115 (D115G)
Ref Sequence ENSEMBL: ENSMUSP00000117621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064129] [ENSMUST00000106618] [ENSMUST00000106619] [ENSMUST00000124209] [ENSMUST00000139237] [ENSMUST00000153315]
Predicted Effect probably damaging
Transcript: ENSMUST00000064129
AA Change: D141G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000066334
Gene: ENSMUSG00000028555
AA Change: D141G

DomainStartEndE-ValueType
TPR 278 311 7.69e1 SMART
TPR 468 501 6.57e1 SMART
TPR 509 542 1.42e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106618
AA Change: D143G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102229
Gene: ENSMUSG00000028555
AA Change: D143G

DomainStartEndE-ValueType
TPR 280 313 7.69e1 SMART
TPR 470 503 6.57e1 SMART
TPR 511 544 1.42e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106619
SMART Domains Protein: ENSMUSP00000102230
Gene: ENSMUSG00000028555

DomainStartEndE-ValueType
Pfam:DUF3808 27 143 1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124209
AA Change: D115G

PolyPhen 2 Score 0.389 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000118672
Gene: ENSMUSG00000028555
AA Change: D115G

DomainStartEndE-ValueType
Pfam:DUF3808 1 137 6.6e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126797
Predicted Effect probably benign
Transcript: ENSMUST00000139237
AA Change: D89G

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000121779
Gene: ENSMUSG00000028555
AA Change: D89G

DomainStartEndE-ValueType
Pfam:DUF3808 1 109 7.2e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150909
Predicted Effect probably damaging
Transcript: ENSMUST00000153315
AA Change: D115G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000117621
Gene: ENSMUSG00000028555
AA Change: D115G

DomainStartEndE-ValueType
Pfam:DUF3808 1 160 2.6e-53 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc7 A G 5: 122,440,170 N406S probably benign Het
Arhgap4 C T X: 73,906,783 R54Q probably damaging Het
Asb15 T A 6: 24,556,557 I17N probably damaging Het
Atp8a1 T C 5: 67,756,696 probably null Het
Caprin1 A G 2: 103,796,801 V47A probably benign Het
Col4a2 T C 8: 11,414,779 V348A probably benign Het
Disp2 A G 2: 118,792,006 K1073R probably damaging Het
Dmxl2 G A 9: 54,405,906 H1686Y possibly damaging Het
Dzank1 C T 2: 144,511,512 V152I probably benign Het
Evl T A 12: 108,648,422 I25N probably damaging Het
Fam117a A G 11: 95,380,873 K424E probably damaging Het
Gm17732 C T 18: 62,662,752 probably benign Het
Gpr158 T C 2: 21,815,669 I659T possibly damaging Het
Hectd4 T A 5: 121,304,337 V1280E possibly damaging Het
Ikbkap A T 4: 56,792,105 I221N possibly damaging Het
Irs4 T C X: 141,725,075 T42A probably damaging Het
Kdm4a C T 4: 118,142,511 V905I probably damaging Het
Lmtk3 T A 7: 45,795,556 probably benign Het
Lsp1 G A 7: 142,489,378 R221H probably damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mut A T 17: 40,947,166 I408F probably damaging Het
Nckap1 A T 2: 80,512,729 V942E probably benign Het
Neto1 T A 18: 86,473,660 C229S possibly damaging Het
Nipal2 A G 15: 34,650,398 I63T probably damaging Het
Olfr1299 A T 2: 111,664,880 Y218F probably damaging Het
Olfr366 G A 2: 37,220,106 V206I probably damaging Het
Olfr58 A T 9: 19,783,939 R269W probably damaging Het
Olfr744 T C 14: 50,618,510 I96T probably damaging Het
Olfr957 C A 9: 39,511,514 V69F possibly damaging Het
Pgpep1 T C 8: 70,650,633 E120G probably benign Het
Pkhd1 A T 1: 20,117,173 M3637K probably benign Het
Pkm T C 9: 59,665,881 V58A probably damaging Het
Ppp2r1b C A 9: 50,861,685 T154K probably damaging Het
Rgs18 T A 1: 144,756,080 D98V possibly damaging Het
Rsph6a G T 7: 19,065,961 A506S possibly damaging Het
Selenop T A 15: 3,275,701 V113E probably damaging Het
Slc6a11 G A 6: 114,244,890 V514M probably benign Het
Srsf9 C T 5: 115,332,637 S132L probably damaging Het
Tchh G A 3: 93,443,781 R176H possibly damaging Het
Tcp11 T C 17: 28,067,810 N405S probably damaging Het
Tle1 A C 4: 72,118,347 D760E probably damaging Het
Tmem178 A G 17: 80,945,059 D124G possibly damaging Het
Trabd G A 15: 89,082,726 E118K probably damaging Het
Uaca T A 9: 60,871,097 M920K possibly damaging Het
Uba2 A T 7: 34,161,613 M5K probably damaging Het
Unc5c C T 3: 141,771,102 P343L probably damaging Het
Wdhd1 T C 14: 47,263,586 D453G probably damaging Het
Wfdc8 A G 2: 164,603,225 Y157H probably damaging Het
Zbbx T G 3: 75,078,450 K432Q probably benign Het
Zeb2 G A 2: 45,017,426 T169M probably benign Het
Zfp956 A G 6: 47,956,028 E79G probably damaging Het
Zzef1 G A 11: 72,818,069 V165I probably benign Het
Other mutations in Ttc39a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Ttc39a APN 4 109442345 splice site probably benign
IGL01143:Ttc39a APN 4 109442813 critical splice donor site probably null
IGL01802:Ttc39a APN 4 109433084 nonsense probably null
IGL01906:Ttc39a APN 4 109421394 missense probably benign 0.04
IGL02115:Ttc39a APN 4 109426294 splice site probably benign
IGL02415:Ttc39a APN 4 109431529 unclassified probably benign
IGL02658:Ttc39a APN 4 109422893 missense probably damaging 1.00
IGL02728:Ttc39a APN 4 109442723 missense probably damaging 1.00
IGL03281:Ttc39a APN 4 109433022 missense possibly damaging 0.84
R0030:Ttc39a UTSW 4 109422973 missense probably benign
R0103:Ttc39a UTSW 4 109421453 intron probably null
R0194:Ttc39a UTSW 4 109444179 missense probably benign
R0561:Ttc39a UTSW 4 109440602 missense probably damaging 1.00
R2132:Ttc39a UTSW 4 109442706 missense probably damaging 1.00
R2203:Ttc39a UTSW 4 109431588 missense probably benign 0.19
R2473:Ttc39a UTSW 4 109442239 missense probably damaging 0.97
R4449:Ttc39a UTSW 4 109442303 missense possibly damaging 0.82
R4809:Ttc39a UTSW 4 109416021 nonsense probably null
R5266:Ttc39a UTSW 4 109422504 missense probably benign 0.04
R5590:Ttc39a UTSW 4 109432987 critical splice acceptor site probably null
R5911:Ttc39a UTSW 4 109422971 missense possibly damaging 0.79
R5930:Ttc39a UTSW 4 109430878 missense probably benign
R7058:Ttc39a UTSW 4 109431566 missense probably damaging 1.00
R7771:Ttc39a UTSW 4 109431450 missense probably damaging 1.00
R7791:Ttc39a UTSW 4 109426347 missense probably benign 0.00
R7849:Ttc39a UTSW 4 109422490 missense probably benign 0.00
R7932:Ttc39a UTSW 4 109422490 missense probably benign 0.00
X0013:Ttc39a UTSW 4 109433137 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CAGGATTGGGGTTACCAGACAAACG -3'
(R):5'- AGCCACCCACAATTCAGTCTGAGG -3'

Sequencing Primer
(F):5'- ctgtctgtctgcctgcc -3'
(R):5'- CAATTCAGTCTGAGGGGATAGGTC -3'
Posted On2013-07-11