Incidental Mutation 'PIT4445001:Gabrb1'
ID 555390
Institutional Source Beutler Lab
Gene Symbol Gabrb1
Ensembl Gene ENSMUSG00000029212
Gene Name gamma-aminobutyric acid (GABA) A receptor, subunit beta 1
Synonyms Gabrb-1, B230208N19Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # PIT4445001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 71658113-72149037 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 72108782 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 261 (S261P)
Ref Sequence ENSEMBL: ENSMUSP00000031122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031122] [ENSMUST00000199967]
AlphaFold P50571
Predicted Effect probably damaging
Transcript: ENSMUST00000031122
AA Change: S261P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031122
Gene: ENSMUSG00000029212
AA Change: S261P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Neur_chan_LBD 37 243 7.1e-52 PFAM
Pfam:Neur_chan_memb 250 469 2.4e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199967
SMART Domains Protein: ENSMUSP00000143682
Gene: ENSMUSG00000029212

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 4 210 4.8e-51 PFAM
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 90.8%
  • 10x: 84.5%
  • 20x: 70.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gamma-aminobutyric acid (GABA) A receptor is a multisubunit chloride channel that mediates the fastest inhibitory synaptic transmission in the central nervous system. This gene encodes GABA A receptor, beta 1 subunit. It is mapped to chromosome 4p12 in a cluster comprised of genes encoding alpha 4, alpha 2 and gamma 1 subunits of the GABA A receptor. Alteration of this gene is implicated in the pathogenetics of schizophrenia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for an ENU or spontaneous mutation exhibit alcohol preference with increased tonic inhibition, female infertility and hypothalamic pituitary axis dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,075,551 K419E probably damaging Het
Adam7 T A 14: 68,509,748 K587N possibly damaging Het
Agl T C 3: 116,771,460 M382V Het
Agpat3 A T 10: 78,274,093 F341I possibly damaging Het
Ampd2 A T 3: 108,075,012 L767Q probably damaging Het
Arhgap28 A T 17: 67,896,235 D124E possibly damaging Het
Arhgap32 T C 9: 32,260,856 L1644P probably damaging Het
Asic4 T C 1: 75,451,127 V99A probably benign Het
Asns T A 6: 7,689,277 N75I probably damaging Het
Atp10a A G 7: 58,803,467 D798G probably damaging Het
Atp8a1 A G 5: 67,622,660 V1145A Het
BC017158 A G 7: 128,276,534 V243A probably benign Het
Ccdc171 A G 4: 83,661,747 Q577R probably damaging Het
Cd247 T A 1: 165,861,036 D154E probably damaging Het
Ceacam1 A T 7: 25,476,456 N104K probably damaging Het
Chfr A G 5: 110,151,677 D312G possibly damaging Het
Ddb1 C A 19: 10,625,970 L881I probably damaging Het
Dgkh A T 14: 78,575,942 I1032N possibly damaging Het
Efcab6 A T 15: 83,904,267 V942D probably benign Het
Fmo5 A G 3: 97,651,528 T435A probably benign Het
Fpr1 T C 17: 17,876,893 Q278R probably benign Het
Fzr1 C T 10: 81,369,394 W256* probably null Het
Galr2 G T 11: 116,281,648 A55S probably benign Het
Gbp2 A T 3: 142,637,466 K581N probably benign Het
Gm7682 T G 5: 94,448,507 W468G probably benign Het
Gria1 A T 11: 57,185,838 Y89F probably damaging Het
Ibsp T A 5: 104,302,304 I26N possibly damaging Het
Igf1r T C 7: 68,207,463 F1058L probably damaging Het
Ighv1-16 A C 12: 114,666,060 C36G probably benign Het
Igll1 T C 16: 16,860,919 T176A probably benign Het
Ilkap T C 1: 91,385,345 T143A probably benign Het
Kdm3b A T 18: 34,793,115 K103* probably null Het
Mphosph9 A G 5: 124,298,790 I497T possibly damaging Het
Mrgpra3 G A 7: 47,590,160 T6I possibly damaging Het
Mrpl38 T C 11: 116,132,558 probably null Het
Myo3a A T 2: 22,542,415 E813V possibly damaging Het
Myo7b G T 18: 31,959,466 Q2093K possibly damaging Het
Myo7b T C 18: 31,962,352 K1851R probably damaging Het
P3h2 T A 16: 25,984,999 D339V probably benign Het
Pcdhb6 C A 18: 37,335,247 P407Q possibly damaging Het
Plch2 C A 4: 155,009,026 R153L probably damaging Het
Plppr4 G A 3: 117,360,308 probably benign Het
Ppp1r3a A G 6: 14,717,777 F1046S probably damaging Het
Prkacb A T 3: 146,755,691 L107M probably benign Het
Ranbp17 A G 11: 33,481,020 probably null Het
Rasl11b C A 5: 74,197,333 P88Q probably damaging Het
Rcc2 A G 4: 140,721,149 E503G possibly damaging Het
Rnf216 T A 5: 143,086,003 K407N probably damaging Het
Scrn3 G A 2: 73,318,329 M81I possibly damaging Het
Scube2 T C 7: 109,809,180 T687A probably benign Het
Serpinb10 T A 1: 107,535,998 F3L probably benign Het
Sgcb C T 5: 73,639,812 V202I probably damaging Het
Sgce A G 6: 4,689,654 V429A possibly damaging Het
Sh3rf2 T C 18: 42,153,164 V574A probably benign Het
Sncaip T C 18: 52,868,944 L179S probably damaging Het
Sntg2 A T 12: 30,312,572 D58E probably damaging Het
Taar3 T C 10: 23,949,688 I44T possibly damaging Het
Tmem87b G A 2: 128,831,471 V227I probably benign Het
Tnfsf9 T C 17: 57,105,517 L29P possibly damaging Het
Tnip2 T C 5: 34,496,871 H391R probably benign Het
Traf5 A G 1: 191,997,807 Y125H Het
Ttc23 T G 7: 67,667,213 I77M probably damaging Het
Ube2l3 T C 16: 17,160,172 N43S probably benign Het
Vars2 A T 17: 35,666,211 C142* probably null Het
Vmn2r15 A C 5: 109,287,142 D565E probably damaging Het
Vmn2r56 C T 7: 12,715,226 probably null Het
Vmn2r79 A T 7: 87,002,200 D269V possibly damaging Het
Vmn2r85 A T 10: 130,425,703 M255K probably benign Het
Wfdc6a T A 2: 164,579,826 *137C probably null Het
Wipi2 T C 5: 142,666,884 V417A probably benign Het
Xirp2 G T 2: 67,509,772 V786L possibly damaging Het
Zdhhc13 G A 7: 48,795,949 G26S probably benign Het
Zscan25 T A 5: 145,290,612 V362D probably damaging Het
Other mutations in Gabrb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00770:Gabrb1 APN 5 72108446 critical splice donor site probably null
IGL00774:Gabrb1 APN 5 72108446 critical splice donor site probably null
IGL01534:Gabrb1 APN 5 71869429 missense possibly damaging 0.95
IGL02170:Gabrb1 APN 5 72136730 missense probably damaging 1.00
IGL02326:Gabrb1 APN 5 71700847 missense probably damaging 0.99
IGL03278:Gabrb1 APN 5 71869596 missense probably damaging 1.00
IGL03345:Gabrb1 APN 5 72136565 missense possibly damaging 0.53
IGL03050:Gabrb1 UTSW 5 72122154 missense probably benign 0.03
PIT4515001:Gabrb1 UTSW 5 71700817 missense probably damaging 1.00
R0109:Gabrb1 UTSW 5 72121946 splice site probably benign
R0386:Gabrb1 UTSW 5 72108807 missense probably damaging 0.99
R1512:Gabrb1 UTSW 5 72108704 missense probably damaging 1.00
R1512:Gabrb1 UTSW 5 72108705 missense probably damaging 1.00
R1717:Gabrb1 UTSW 5 72108351 splice site probably null
R1832:Gabrb1 UTSW 5 72121938 splice site probably null
R1961:Gabrb1 UTSW 5 71700336 missense probably benign 0.28
R2363:Gabrb1 UTSW 5 71869573 nonsense probably null
R4686:Gabrb1 UTSW 5 71700022 missense possibly damaging 0.53
R4840:Gabrb1 UTSW 5 71700811 missense probably damaging 1.00
R4916:Gabrb1 UTSW 5 71869421 missense probably damaging 1.00
R4941:Gabrb1 UTSW 5 72136778 missense probably damaging 1.00
R5250:Gabrb1 UTSW 5 71869579 missense possibly damaging 0.80
R5270:Gabrb1 UTSW 5 72108326 missense probably damaging 1.00
R5364:Gabrb1 UTSW 5 72136762 missense probably benign 0.33
R5407:Gabrb1 UTSW 5 72122021 missense possibly damaging 0.90
R5621:Gabrb1 UTSW 5 72108728 missense probably damaging 1.00
R5790:Gabrb1 UTSW 5 72136484 missense possibly damaging 0.53
R6236:Gabrb1 UTSW 5 72108320 missense probably damaging 1.00
R6336:Gabrb1 UTSW 5 72029898 missense possibly damaging 0.72
R7411:Gabrb1 UTSW 5 72122195 critical splice donor site probably null
R8375:Gabrb1 UTSW 5 72029829 missense probably damaging 0.98
R9161:Gabrb1 UTSW 5 72029856 missense probably damaging 0.98
R9474:Gabrb1 UTSW 5 72108347 missense probably damaging 1.00
R9621:Gabrb1 UTSW 5 72122020 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AACTTGTGCGTTGTGAAAGAG -3'
(R):5'- TTAAGCGTCCCATTGCAGC -3'

Sequencing Primer
(F):5'- CTTGTGCGTTGTGAAAGAGAGATAG -3'
(R):5'- GCGTCCCATTGCAGCCTAATTC -3'
Posted On 2019-06-07