Incidental Mutation 'R0603:Atp8a1'
ID55540
Institutional Source Beutler Lab
Gene Symbol Atp8a1
Ensembl Gene ENSMUSG00000037685
Gene NameATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1
SynonymsB230107D19Rik, Atp3a2
MMRRC Submission 038792-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0603 (G1)
Quality Score212
Status Not validated
Chromosome5
Chromosomal Location67618140-67847434 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 67756696 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000072738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037380] [ENSMUST00000072971] [ENSMUST00000135930] [ENSMUST00000200955]
Predicted Effect probably null
Transcript: ENSMUST00000037380
SMART Domains Protein: ENSMUSP00000042215
Gene: ENSMUSG00000037685

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 38 101 9.8e-27 PFAM
Pfam:E1-E2_ATPase 106 371 3e-11 PFAM
Pfam:HAD 406 810 3.8e-23 PFAM
Pfam:Cation_ATPase 485 585 6e-14 PFAM
Pfam:PhoLip_ATPase_C 827 1079 8.2e-82 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000072971
SMART Domains Protein: ENSMUSP00000072738
Gene: ENSMUSG00000037685

DomainStartEndE-ValueType
Pfam:E1-E2_ATPase 104 375 2.1e-22 PFAM
Pfam:Hydrolase 403 798 2.2e-14 PFAM
Pfam:HAD 406 795 3e-18 PFAM
Pfam:Hydrolase_like2 470 570 4.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135930
SMART Domains Protein: ENSMUSP00000118379
Gene: ENSMUSG00000037685

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 38 101 1.1e-26 PFAM
Pfam:E1-E2_ATPase 106 371 8.6e-14 PFAM
Pfam:HAD 406 795 3.6e-23 PFAM
Pfam:Cation_ATPase 470 570 1.2e-13 PFAM
Pfam:PhoLip_ATPase_C 812 1064 8.4e-82 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155911
Predicted Effect probably benign
Transcript: ENSMUST00000200955
SMART Domains Protein: ENSMUSP00000144465
Gene: ENSMUSG00000037685

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 38 101 7.5e-25 PFAM
Pfam:E1-E2_ATPase 106 371 3.7e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201074
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The P-type adenosinetriphosphatases (P-type ATPases) are a family of proteins which use the free energy of ATP hydrolysis to drive uphill transport of ions across membranes. Several subfamilies of P-type ATPases have been identified. One subfamily catalyzes transport of heavy metal ions. Another subfamily transports non-heavy metal ions (NMHI). The protein encoded by this gene is a member of the third subfamily of P-type ATPases and acts to transport amphipaths, such as phosphatidylserine. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are viable, fertile and phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc7 A G 5: 122,440,170 N406S probably benign Het
Arhgap4 C T X: 73,906,783 R54Q probably damaging Het
Asb15 T A 6: 24,556,557 I17N probably damaging Het
Caprin1 A G 2: 103,796,801 V47A probably benign Het
Col4a2 T C 8: 11,414,779 V348A probably benign Het
Disp2 A G 2: 118,792,006 K1073R probably damaging Het
Dmxl2 G A 9: 54,405,906 H1686Y possibly damaging Het
Dzank1 C T 2: 144,511,512 V152I probably benign Het
Evl T A 12: 108,648,422 I25N probably damaging Het
Fam117a A G 11: 95,380,873 K424E probably damaging Het
Gm17732 C T 18: 62,662,752 probably benign Het
Gpr158 T C 2: 21,815,669 I659T possibly damaging Het
Hectd4 T A 5: 121,304,337 V1280E possibly damaging Het
Ikbkap A T 4: 56,792,105 I221N possibly damaging Het
Irs4 T C X: 141,725,075 T42A probably damaging Het
Kdm4a C T 4: 118,142,511 V905I probably damaging Het
Lmtk3 T A 7: 45,795,556 probably benign Het
Lsp1 G A 7: 142,489,378 R221H probably damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mut A T 17: 40,947,166 I408F probably damaging Het
Nckap1 A T 2: 80,512,729 V942E probably benign Het
Neto1 T A 18: 86,473,660 C229S possibly damaging Het
Nipal2 A G 15: 34,650,398 I63T probably damaging Het
Olfr1299 A T 2: 111,664,880 Y218F probably damaging Het
Olfr366 G A 2: 37,220,106 V206I probably damaging Het
Olfr58 A T 9: 19,783,939 R269W probably damaging Het
Olfr744 T C 14: 50,618,510 I96T probably damaging Het
Olfr957 C A 9: 39,511,514 V69F possibly damaging Het
Pgpep1 T C 8: 70,650,633 E120G probably benign Het
Pkhd1 A T 1: 20,117,173 M3637K probably benign Het
Pkm T C 9: 59,665,881 V58A probably damaging Het
Ppp2r1b C A 9: 50,861,685 T154K probably damaging Het
Rgs18 T A 1: 144,756,080 D98V possibly damaging Het
Rsph6a G T 7: 19,065,961 A506S possibly damaging Het
Selenop T A 15: 3,275,701 V113E probably damaging Het
Slc6a11 G A 6: 114,244,890 V514M probably benign Het
Srsf9 C T 5: 115,332,637 S132L probably damaging Het
Tchh G A 3: 93,443,781 R176H possibly damaging Het
Tcp11 T C 17: 28,067,810 N405S probably damaging Het
Tle1 A C 4: 72,118,347 D760E probably damaging Het
Tmem178 A G 17: 80,945,059 D124G possibly damaging Het
Trabd G A 15: 89,082,726 E118K probably damaging Het
Ttc39a A G 4: 109,426,302 D115G probably damaging Het
Uaca T A 9: 60,871,097 M920K possibly damaging Het
Uba2 A T 7: 34,161,613 M5K probably damaging Het
Unc5c C T 3: 141,771,102 P343L probably damaging Het
Wdhd1 T C 14: 47,263,586 D453G probably damaging Het
Wfdc8 A G 2: 164,603,225 Y157H probably damaging Het
Zbbx T G 3: 75,078,450 K432Q probably benign Het
Zeb2 G A 2: 45,017,426 T169M probably benign Het
Zfp956 A G 6: 47,956,028 E79G probably damaging Het
Zzef1 G A 11: 72,818,069 V165I probably benign Het
Other mutations in Atp8a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00776:Atp8a1 APN 5 67749143 missense probably benign 0.20
IGL00778:Atp8a1 APN 5 67659903 missense possibly damaging 0.58
IGL01068:Atp8a1 APN 5 67667337 missense probably benign 0.02
IGL01152:Atp8a1 APN 5 67847206 missense probably damaging 0.99
IGL01572:Atp8a1 APN 5 67667651 missense probably benign
IGL01608:Atp8a1 APN 5 67813136 nonsense probably null
IGL02171:Atp8a1 APN 5 67738465 missense probably damaging 1.00
IGL02330:Atp8a1 APN 5 67813177 missense probably damaging 0.98
IGL02381:Atp8a1 APN 5 67705995 missense probably benign
IGL02420:Atp8a1 APN 5 67682783 missense probably damaging 1.00
IGL02440:Atp8a1 APN 5 67667434 splice site probably benign
IGL02598:Atp8a1 APN 5 67682756 critical splice donor site probably null
IGL03259:Atp8a1 APN 5 67624006 splice site probably null
IGL03336:Atp8a1 APN 5 67729807 nonsense probably null
IGL03380:Atp8a1 APN 5 67732186 missense probably benign 0.25
PIT4131001:Atp8a1 UTSW 5 67622602 nonsense probably null
PIT4445001:Atp8a1 UTSW 5 67622660 missense
R0208:Atp8a1 UTSW 5 67774721 critical splice donor site probably null
R0276:Atp8a1 UTSW 5 67786673 splice site probably benign
R0279:Atp8a1 UTSW 5 67813092 splice site probably null
R0329:Atp8a1 UTSW 5 67812073 splice site probably benign
R0715:Atp8a1 UTSW 5 67774725 missense probably benign 0.00
R0763:Atp8a1 UTSW 5 67659883 missense probably benign
R1296:Atp8a1 UTSW 5 67622706 splice site probably benign
R1631:Atp8a1 UTSW 5 67749052 splice site probably null
R1764:Atp8a1 UTSW 5 67631567 missense probably benign 0.14
R1771:Atp8a1 UTSW 5 67647731 missense probably damaging 1.00
R1885:Atp8a1 UTSW 5 67747318 missense possibly damaging 0.82
R1897:Atp8a1 UTSW 5 67738429 missense probably damaging 1.00
R1968:Atp8a1 UTSW 5 67667657 missense probably benign 0.05
R2965:Atp8a1 UTSW 5 67647706 missense probably benign 0.28
R2966:Atp8a1 UTSW 5 67647706 missense probably benign 0.28
R4247:Atp8a1 UTSW 5 67667574 missense probably damaging 1.00
R4353:Atp8a1 UTSW 5 67769108 missense probably damaging 1.00
R4400:Atp8a1 UTSW 5 67764878 missense probably benign 0.13
R4426:Atp8a1 UTSW 5 67774828 missense probably benign 0.22
R4523:Atp8a1 UTSW 5 67667600 missense probably benign 0.00
R4576:Atp8a1 UTSW 5 67815815 intron probably benign
R4622:Atp8a1 UTSW 5 67682713 intron probably benign
R4639:Atp8a1 UTSW 5 67655974 missense probably benign 0.36
R4664:Atp8a1 UTSW 5 67762586 missense possibly damaging 0.92
R4732:Atp8a1 UTSW 5 67813120 missense probably benign 0.07
R4733:Atp8a1 UTSW 5 67813120 missense probably benign 0.07
R5071:Atp8a1 UTSW 5 67815723 missense probably benign 0.29
R5267:Atp8a1 UTSW 5 67762544 missense probably damaging 1.00
R5314:Atp8a1 UTSW 5 67705905 critical splice donor site probably null
R5424:Atp8a1 UTSW 5 67812100 missense probably damaging 1.00
R5588:Atp8a1 UTSW 5 67814684 missense probably damaging 1.00
R5698:Atp8a1 UTSW 5 67767153 missense probably benign 0.14
R5815:Atp8a1 UTSW 5 67749071 missense probably benign 0.00
R5977:Atp8a1 UTSW 5 67747285 missense possibly damaging 0.94
R6285:Atp8a1 UTSW 5 67667607 missense possibly damaging 0.68
R6341:Atp8a1 UTSW 5 67682927 missense possibly damaging 0.88
R6736:Atp8a1 UTSW 5 67667617 missense probably damaging 1.00
R6746:Atp8a1 UTSW 5 67751049 missense probably benign 0.00
R6887:Atp8a1 UTSW 5 67738451 missense probably benign 0.21
R6946:Atp8a1 UTSW 5 67622625 missense possibly damaging 0.50
R6970:Atp8a1 UTSW 5 67738462 missense probably damaging 1.00
R7035:Atp8a1 UTSW 5 67781030 missense probably benign 0.00
R7218:Atp8a1 UTSW 5 67702981 missense
R7278:Atp8a1 UTSW 5 67624037 missense
R7530:Atp8a1 UTSW 5 67745628 missense
R7548:Atp8a1 UTSW 5 67815728 nonsense probably null
R7594:Atp8a1 UTSW 5 67651592 missense
R7722:Atp8a1 UTSW 5 67622698 critical splice acceptor site probably null
R8152:Atp8a1 UTSW 5 67762582 missense
X0019:Atp8a1 UTSW 5 67749141 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- ACCCAACACCTGTGAAGATGGCTC -3'
(R):5'- AACTGTGCCCGACATGACTAGC -3'

Sequencing Primer
(F):5'- CTGTGAAGATGGCTCCCAGAG -3'
(R):5'- AAATAATGCACTTCCTACTGGCTC -3'
Posted On2013-07-11