Incidental Mutation 'PIT4445001:Sgce'
ID555401
Institutional Source Beutler Lab
Gene Symbol Sgce
Ensembl Gene ENSMUSG00000004631
Gene Namesarcoglycan, epsilon
Synonymse-SG
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.402) question?
Stock #PIT4445001 (G1)
Quality Score135.008
Status Not validated
Chromosome6
Chromosomal Location4674350-4747207 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4689654 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 429 (V429A)
Ref Sequence ENSEMBL: ENSMUSP00000111240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004750] [ENSMUST00000090686] [ENSMUST00000101677] [ENSMUST00000115577] [ENSMUST00000115579] [ENSMUST00000126151] [ENSMUST00000133306]
Predicted Effect probably damaging
Transcript: ENSMUST00000004750
AA Change: V384A

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000004750
Gene: ENSMUSG00000004631
AA Change: V384A

DomainStartEndE-ValueType
CADG 49 157 1.86e-10 SMART
low complexity region 412 423 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000090686
AA Change: V384A

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000088185
Gene: ENSMUSG00000004631
AA Change: V384A

DomainStartEndE-ValueType
CADG 49 157 1.86e-10 SMART
low complexity region 412 423 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000101677
AA Change: V384A

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099200
Gene: ENSMUSG00000004631
AA Change: V384A

DomainStartEndE-ValueType
CADG 49 157 1.86e-10 SMART
low complexity region 421 432 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115577
AA Change: V429A

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000111240
Gene: ENSMUSG00000004631
AA Change: V429A

DomainStartEndE-ValueType
low complexity region 28 40 N/A INTRINSIC
CADG 85 193 1.86e-10 SMART
low complexity region 457 468 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115579
AA Change: V393A

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000111242
Gene: ENSMUSG00000004631
AA Change: V393A

DomainStartEndE-ValueType
CADG 49 157 1.86e-10 SMART
low complexity region 421 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123907
SMART Domains Protein: ENSMUSP00000120910
Gene: ENSMUSG00000004631

DomainStartEndE-ValueType
CADG 32 140 1.86e-10 SMART
low complexity region 395 406 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000126151
AA Change: V352A

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120718
Gene: ENSMUSG00000004631
AA Change: V352A

DomainStartEndE-ValueType
CADG 26 134 1.86e-10 SMART
low complexity region 389 400 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000133306
AA Change: V393A

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121964
Gene: ENSMUSG00000004631
AA Change: V393A

DomainStartEndE-ValueType
CADG 26 134 1.86e-10 SMART
low complexity region 398 409 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 90.8%
  • 10x: 84.5%
  • 20x: 70.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the epsilon member of the sarcoglycan family. Sarcoglycans are transmembrane proteins that are components of the dystrophin-glycoprotein complex, which link the actin cytoskeleton to the extracellular matrix. Unlike other family members which are predominantly expressed in striated muscle, the epsilon sarcoglycan is more broadly expressed. Mutations in this gene are associated with myoclonus-dystonia syndrome. This gene is imprinted, with preferential expression from the paternal allele. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A pseudogene associated with this gene is located on chromosome 2. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous or heterozygous for a knock-out allele display significantly increased myoclonus and deficits in motor coordination and balance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,075,551 K419E probably damaging Het
Adam7 T A 14: 68,509,748 K587N possibly damaging Het
Agl T C 3: 116,771,460 M382V Het
Agpat3 A T 10: 78,274,093 F341I possibly damaging Het
Ampd2 A T 3: 108,075,012 L767Q probably damaging Het
Arhgap28 A T 17: 67,896,235 D124E possibly damaging Het
Arhgap32 T C 9: 32,260,856 L1644P probably damaging Het
Asic4 T C 1: 75,451,127 V99A probably benign Het
Asns T A 6: 7,689,277 N75I probably damaging Het
Atp10a A G 7: 58,803,467 D798G probably damaging Het
Atp8a1 A G 5: 67,622,660 V1145A Het
BC017158 A G 7: 128,276,534 V243A probably benign Het
Ccdc171 A G 4: 83,661,747 Q577R probably damaging Het
Cd247 T A 1: 165,861,036 D154E probably damaging Het
Ceacam1 A T 7: 25,476,456 N104K probably damaging Het
Chfr A G 5: 110,151,677 D312G possibly damaging Het
Ddb1 C A 19: 10,625,970 L881I probably damaging Het
Dgkh A T 14: 78,575,942 I1032N possibly damaging Het
Efcab6 A T 15: 83,904,267 V942D probably benign Het
Fmo5 A G 3: 97,651,528 T435A probably benign Het
Fpr1 T C 17: 17,876,893 Q278R probably benign Het
Fzr1 C T 10: 81,369,394 W256* probably null Het
Gabrb1 T C 5: 72,108,782 S261P probably damaging Het
Galr2 G T 11: 116,281,648 A55S probably benign Het
Gbp2 A T 3: 142,637,466 K581N probably benign Het
Gm7682 T G 5: 94,448,507 W468G probably benign Het
Gria1 A T 11: 57,185,838 Y89F probably damaging Het
Ibsp T A 5: 104,302,304 I26N possibly damaging Het
Igf1r T C 7: 68,207,463 F1058L probably damaging Het
Ighv1-16 A C 12: 114,666,060 C36G probably benign Het
Igll1 T C 16: 16,860,919 T176A probably benign Het
Ilkap T C 1: 91,385,345 T143A probably benign Het
Kdm3b A T 18: 34,793,115 K103* probably null Het
Mphosph9 A G 5: 124,298,790 I497T possibly damaging Het
Mrgpra3 G A 7: 47,590,160 T6I possibly damaging Het
Mrpl38 T C 11: 116,132,558 probably null Het
Myo3a A T 2: 22,542,415 E813V possibly damaging Het
Myo7b G T 18: 31,959,466 Q2093K possibly damaging Het
Myo7b T C 18: 31,962,352 K1851R probably damaging Het
P3h2 T A 16: 25,984,999 D339V probably benign Het
Pcdhb6 C A 18: 37,335,247 P407Q possibly damaging Het
Plch2 C A 4: 155,009,026 R153L probably damaging Het
Plppr4 G A 3: 117,360,308 probably benign Het
Ppp1r3a A G 6: 14,717,777 F1046S probably damaging Het
Prkacb A T 3: 146,755,691 L107M probably benign Het
Ranbp17 A G 11: 33,481,020 probably null Het
Rasl11b C A 5: 74,197,333 P88Q probably damaging Het
Rcc2 A G 4: 140,721,149 E503G possibly damaging Het
Rnf216 T A 5: 143,086,003 K407N probably damaging Het
Scrn3 G A 2: 73,318,329 M81I possibly damaging Het
Scube2 T C 7: 109,809,180 T687A probably benign Het
Serpinb10 T A 1: 107,535,998 F3L probably benign Het
Sgcb C T 5: 73,639,812 V202I probably damaging Het
Sh3rf2 T C 18: 42,153,164 V574A probably benign Het
Sncaip T C 18: 52,868,944 L179S probably damaging Het
Sntg2 A T 12: 30,312,572 D58E probably damaging Het
Taar3 T C 10: 23,949,688 I44T possibly damaging Het
Tmem87b G A 2: 128,831,471 V227I probably benign Het
Tnfsf9 T C 17: 57,105,517 L29P possibly damaging Het
Tnip2 T C 5: 34,496,871 H391R probably benign Het
Traf5 A G 1: 191,997,807 Y125H Het
Ttc23 T G 7: 67,667,213 I77M probably damaging Het
Ube2l3 T C 16: 17,160,172 N43S probably benign Het
Vars2 A T 17: 35,666,211 C142* probably null Het
Vmn2r15 A C 5: 109,287,142 D565E probably damaging Het
Vmn2r56 C T 7: 12,715,226 probably null Het
Vmn2r79 A T 7: 87,002,200 D269V possibly damaging Het
Vmn2r85 A T 10: 130,425,703 M255K probably benign Het
Wfdc6a T A 2: 164,579,826 *137C probably null Het
Wipi2 T C 5: 142,666,884 V417A probably benign Het
Xirp2 G T 2: 67,509,772 V786L possibly damaging Het
Zdhhc13 G A 7: 48,795,949 G26S probably benign Het
Zscan25 T A 5: 145,290,612 V362D probably damaging Het
Other mutations in Sgce
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Sgce APN 6 4689750 missense probably damaging 1.00
IGL01399:Sgce APN 6 4746997 missense probably damaging 1.00
IGL01796:Sgce APN 6 4711326 missense probably damaging 1.00
IGL02403:Sgce APN 6 4694059 missense probably damaging 1.00
IGL02421:Sgce APN 6 4694187 splice site probably benign
IGL02547:Sgce APN 6 4711301 splice site probably benign
IGL02585:Sgce APN 6 4711388 splice site probably benign
IGL03355:Sgce APN 6 4689738 missense probably damaging 1.00
IGL03374:Sgce APN 6 4689718 nonsense probably null
R0345:Sgce UTSW 6 4718019 missense probably damaging 1.00
R0611:Sgce UTSW 6 4689621 missense probably damaging 1.00
R0719:Sgce UTSW 6 4689753 missense probably damaging 1.00
R1162:Sgce UTSW 6 4691419 splice site probably benign
R1630:Sgce UTSW 6 4719476 missense probably damaging 0.98
R1694:Sgce UTSW 6 4689709 missense probably damaging 1.00
R1759:Sgce UTSW 6 4689765 missense probably damaging 1.00
R1897:Sgce UTSW 6 4691511 missense probably benign 0.00
R2231:Sgce UTSW 6 4730066 missense probably benign 0.44
R3429:Sgce UTSW 6 4730008 missense probably benign 0.01
R4011:Sgce UTSW 6 4691563 nonsense probably null
R4426:Sgce UTSW 6 4691459 missense probably damaging 0.97
R4427:Sgce UTSW 6 4691459 missense probably damaging 0.97
R4651:Sgce UTSW 6 4689560 intron probably benign
R4652:Sgce UTSW 6 4689560 intron probably benign
R4921:Sgce UTSW 6 4694153 missense probably damaging 1.00
R4974:Sgce UTSW 6 4689630 missense probably benign 0.00
R6271:Sgce UTSW 6 4730015 missense possibly damaging 0.81
R6898:Sgce UTSW 6 4689666 missense probably damaging 1.00
R7317:Sgce UTSW 6 4691615 missense probably benign 0.00
R7347:Sgce UTSW 6 4694106 missense probably damaging 1.00
R7512:Sgce UTSW 6 4707192 missense possibly damaging 0.75
R7671:Sgce UTSW 6 4691564 missense probably damaging 1.00
R8009:Sgce UTSW 6 4691636 missense probably damaging 0.99
X0026:Sgce UTSW 6 4689638 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- TACATTTCTGTCAAGCCAAGTGATG -3'
(R):5'- ACTCATTACGGCTAGTGCGTC -3'

Sequencing Primer
(F):5'- CAAGCCAAGTGATGATATTTTGACAC -3'
(R):5'- GGCTAGTGCGTCATTTTAAATATATG -3'
Posted On2019-06-07