Mutagenetix > Incidental Mutations

Incidental Mutation 'PIT4445001:Atp10a'

555408

Institutional Source

Beutler Lab

Gene Symbol

Atp10a

Ensembl Gene

ENSMUSG00000025324

Gene Name

ATPase, class V, type 10A

Synonyms

Atp10c, pfatp

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.299) question?

Stock #

PIT4445001 (G1)

Quality Score

170.009

Status

Not validated

Chromosome

Chromosomal Location

58656166-58829420 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 58803467 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 798 (D798G)

Ref Sequence

ENSEMBL: ENSMUSP00000129811 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168747]

Predicted Effect

probably damaging
Transcript: ENSMUST00000168747
AA Change: D798G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000129811
Gene: ENSMUSG00000025324
AA Change: D798G

Domain	Start	End	E-Value	Type
low complexity region	15	32	N/A	INTRINSIC
Pfam:PhoLip_ATPase_N	55	114	5.2e-23	PFAM
Pfam:E1-E2_ATPase	120	393	6.6e-10	PFAM
low complexity region	633	643	N/A	INTRINSIC
Pfam:Cation_ATPase	685	791	1.5e-7	PFAM
Pfam:HAD	697	1054	2.1e-12	PFAM
Pfam:PhoLip_ATPase_C	1071	1316	1.1e-76	PFAM
low complexity region	1458	1477	N/A	INTRINSIC

Coding Region Coverage

1x: 93.5%
3x: 90.8%
10x: 84.5%
20x: 70.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. This gene is maternally expressed. It maps within the most common interval of deletion responsible for Angelman syndrome, also known as 'happy puppet syndrome'. [provided by RefSeq, Jul 2008]
PHENOTYPE: Disruption of this gene at the distal end of the p^23DFiOD deletion may be responsible for the obesity phenotypes associated with that deletion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8a	T	C	11: 110,075,551	K419E	probably damaging	Het
Adam7	T	A	14: 68,509,748	K587N	possibly damaging	Het
Agl	T	C	3: 116,771,460	M382V		Het
Agpat3	A	T	10: 78,274,093	F341I	possibly damaging	Het
Ampd2	A	T	3: 108,075,012	L767Q	probably damaging	Het
Arhgap28	A	T	17: 67,896,235	D124E	possibly damaging	Het
Arhgap32	T	C	9: 32,260,856	L1644P	probably damaging	Het
Asic4	T	C	1: 75,451,127	V99A	probably benign	Het
Asns	T	A	6: 7,689,277	N75I	probably damaging	Het
Atp8a1	A	G	5: 67,622,660	V1145A		Het
BC017158	A	G	7: 128,276,534	V243A	probably benign	Het
Ccdc171	A	G	4: 83,661,747	Q577R	probably damaging	Het
Cd247	T	A	1: 165,861,036	D154E	probably damaging	Het
Ceacam1	A	T	7: 25,476,456	N104K	probably damaging	Het
Chfr	A	G	5: 110,151,677	D312G	possibly damaging	Het
Ddb1	C	A	19: 10,625,970	L881I	probably damaging	Het
Dgkh	A	T	14: 78,575,942	I1032N	possibly damaging	Het
Efcab6	A	T	15: 83,904,267	V942D	probably benign	Het
Fmo5	A	G	3: 97,651,528	T435A	probably benign	Het
Fpr1	T	C	17: 17,876,893	Q278R	probably benign	Het
Fzr1	C	T	10: 81,369,394	W256*	probably null	Het
Gabrb1	T	C	5: 72,108,782	S261P	probably damaging	Het
Galr2	G	T	11: 116,281,648	A55S	probably benign	Het
Gbp2	A	T	3: 142,637,466	K581N	probably benign	Het
Gm7682	T	G	5: 94,448,507	W468G	probably benign	Het
Gria1	A	T	11: 57,185,838	Y89F	probably damaging	Het
Ibsp	T	A	5: 104,302,304	I26N	possibly damaging	Het
Igf1r	T	C	7: 68,207,463	F1058L	probably damaging	Het
Ighv1-16	A	C	12: 114,666,060	C36G	probably benign	Het
Igll1	T	C	16: 16,860,919	T176A	probably benign	Het
Ilkap	T	C	1: 91,385,345	T143A	probably benign	Het
Kdm3b	A	T	18: 34,793,115	K103*	probably null	Het
Mphosph9	A	G	5: 124,298,790	I497T	possibly damaging	Het
Mrgpra3	G	A	7: 47,590,160	T6I	possibly damaging	Het
Mrpl38	T	C	11: 116,132,558		probably null	Het
Myo3a	A	T	2: 22,542,415	E813V	possibly damaging	Het
Myo7b	G	T	18: 31,959,466	Q2093K	possibly damaging	Het
Myo7b	T	C	18: 31,962,352	K1851R	probably damaging	Het
P3h2	T	A	16: 25,984,999	D339V	probably benign	Het
Pcdhb6	C	A	18: 37,335,247	P407Q	possibly damaging	Het
Plch2	C	A	4: 155,009,026	R153L	probably damaging	Het
Plppr4	G	A	3: 117,360,308		probably benign	Het
Ppp1r3a	A	G	6: 14,717,777	F1046S	probably damaging	Het
Prkacb	A	T	3: 146,755,691	L107M	probably benign	Het
Ranbp17	A	G	11: 33,481,020		probably null	Het
Rasl11b	C	A	5: 74,197,333	P88Q	probably damaging	Het
Rcc2	A	G	4: 140,721,149	E503G	possibly damaging	Het
Rnf216	T	A	5: 143,086,003	K407N	probably damaging	Het
Scrn3	G	A	2: 73,318,329	M81I	possibly damaging	Het
Scube2	T	C	7: 109,809,180	T687A	probably benign	Het
Serpinb10	T	A	1: 107,535,998	F3L	probably benign	Het
Sgcb	C	T	5: 73,639,812	V202I	probably damaging	Het
Sgce	A	G	6: 4,689,654	V429A	possibly damaging	Het
Sh3rf2	T	C	18: 42,153,164	V574A	probably benign	Het
Sncaip	T	C	18: 52,868,944	L179S	probably damaging	Het
Sntg2	A	T	12: 30,312,572	D58E	probably damaging	Het
Taar3	T	C	10: 23,949,688	I44T	possibly damaging	Het
Tmem87b	G	A	2: 128,831,471	V227I	probably benign	Het
Tnfsf9	T	C	17: 57,105,517	L29P	possibly damaging	Het
Tnip2	T	C	5: 34,496,871	H391R	probably benign	Het
Traf5	A	G	1: 191,997,807	Y125H		Het
Ttc23	T	G	7: 67,667,213	I77M	probably damaging	Het
Ube2l3	T	C	16: 17,160,172	N43S	probably benign	Het
Vars2	A	T	17: 35,666,211	C142*	probably null	Het
Vmn2r15	A	C	5: 109,287,142	D565E	probably damaging	Het
Vmn2r56	C	T	7: 12,715,226		probably null	Het
Vmn2r79	A	T	7: 87,002,200	D269V	possibly damaging	Het
Vmn2r85	A	T	10: 130,425,703	M255K	probably benign	Het
Wfdc6a	T	A	2: 164,579,826	*137C	probably null	Het
Wipi2	T	C	5: 142,666,884	V417A	probably benign	Het
Xirp2	G	T	2: 67,509,772	V786L	possibly damaging	Het
Zdhhc13	G	A	7: 48,795,949	G26S	probably benign	Het
Zscan25	T	A	5: 145,290,612	V362D	probably damaging	Het

Other mutations in Atp10a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00649:Atp10a	APN	7	58794482	missense	probably benign	0.06
IGL00973:Atp10a	APN	7	58807470	missense	probably damaging	1.00
IGL00984:Atp10a	APN	7	58658741	missense	probably damaging	1.00
IGL01086:Atp10a	APN	7	58824318	missense	probably damaging	0.96
IGL01296:Atp10a	APN	7	58813625	missense	probably benign	0.02
IGL01731:Atp10a	APN	7	58797562	missense	probably benign	0.16
IGL02081:Atp10a	APN	7	58827856	missense	possibly damaging	0.62
IGL02095:Atp10a	APN	7	58807393	missense	probably damaging	1.00
IGL02549:Atp10a	APN	7	58819733	missense	probably benign	0.00
IGL02558:Atp10a	APN	7	58819642	missense	probably damaging	0.98
IGL02659:Atp10a	APN	7	58813631	missense	probably benign
IGL02986:Atp10a	APN	7	58828721	missense	probably benign
IGL03218:Atp10a	APN	7	58788448	critical splice donor site	probably null
PIT4260001:Atp10a	UTSW	7	58791118	nonsense	probably null
PIT4810001:Atp10a	UTSW	7	58813848	missense	probably damaging	0.99
R0091:Atp10a	UTSW	7	58774046	splice site	probably benign
R0349:Atp10a	UTSW	7	58803467	missense	probably damaging	0.98
R0426:Atp10a	UTSW	7	58784734	missense	probably benign	0.00
R0609:Atp10a	UTSW	7	58819740	splice site	probably null
R0722:Atp10a	UTSW	7	58816183	missense	possibly damaging	0.75
R0741:Atp10a	UTSW	7	58828589	missense	possibly damaging	0.90
R1172:Atp10a	UTSW	7	58803766	missense	probably benign	0.05
R1342:Atp10a	UTSW	7	58816146	splice site	probably benign
R1648:Atp10a	UTSW	7	58784827	missense	probably damaging	1.00
R1715:Atp10a	UTSW	7	58786505	missense	probably damaging	0.98
R1737:Atp10a	UTSW	7	58827238	splice site	probably benign
R1799:Atp10a	UTSW	7	58824434	missense	probably damaging	1.00
R1909:Atp10a	UTSW	7	58828712	missense	probably benign	0.12
R1918:Atp10a	UTSW	7	58827935	missense	possibly damaging	0.82
R2031:Atp10a	UTSW	7	58827930	nonsense	probably null
R2080:Atp10a	UTSW	7	58824327	missense	probably damaging	0.97
R2424:Atp10a	UTSW	7	58794555	missense	probably benign	0.16
R2696:Atp10a	UTSW	7	58813618	missense	probably benign	0.00
R3932:Atp10a	UTSW	7	58827104	missense	possibly damaging	0.69
R4198:Atp10a	UTSW	7	58813686	missense	probably damaging	1.00
R4453:Atp10a	UTSW	7	58658500	small deletion	probably benign
R4632:Atp10a	UTSW	7	58807438	missense	possibly damaging	0.48
R4661:Atp10a	UTSW	7	58658500	small deletion	probably benign
R4782:Atp10a	UTSW	7	58791095	missense	probably benign
R4888:Atp10a	UTSW	7	58785307	missense	probably damaging	1.00
R4935:Atp10a	UTSW	7	58813764	missense	probably damaging	1.00
R5051:Atp10a	UTSW	7	58740246	frame shift	probably null
R5213:Atp10a	UTSW	7	58773983	missense	probably damaging	0.99
R5617:Atp10a	UTSW	7	58803675	missense	probably benign	0.06
R5834:Atp10a	UTSW	7	58658618	missense	probably benign	0.01
R5885:Atp10a	UTSW	7	58813800	missense	possibly damaging	0.92
R6013:Atp10a	UTSW	7	58797790	missense	probably benign	0.05
R6136:Atp10a	UTSW	7	58828340	missense	probably benign
R6269:Atp10a	UTSW	7	58803739	missense	possibly damaging	0.51
R6380:Atp10a	UTSW	7	58819684	nonsense	probably null
R6743:Atp10a	UTSW	7	58797814	missense	possibly damaging	0.89
R6875:Atp10a	UTSW	7	58797352	missense	probably benign	0.01
R6975:Atp10a	UTSW	7	58773985	missense	probably damaging	1.00
R7082:Atp10a	UTSW	7	58658819	missense	probably damaging	1.00
R7203:Atp10a	UTSW	7	58786473	missense	probably benign
R7224:Atp10a	UTSW	7	58797471	missense	probably benign	0.00
R7287:Atp10a	UTSW	7	58827269	missense	probably damaging	1.00
R7437:Atp10a	UTSW	7	58658540	missense	unknown
R7474:Atp10a	UTSW	7	58658527	missense	unknown
R7530:Atp10a	UTSW	7	58773976	missense	probably benign	0.02
R7561:Atp10a	UTSW	7	58827133	missense	probably damaging	0.98
R7743:Atp10a	UTSW	7	58803709	missense	probably damaging	1.00
R7767:Atp10a	UTSW	7	58658849	missense	probably damaging	1.00
R7861:Atp10a	UTSW	7	58788359	missense	probably damaging	1.00
R7903:Atp10a	UTSW	7	58658822	missense	probably damaging	1.00
R7944:Atp10a	UTSW	7	58788359	missense	probably damaging	1.00
R7986:Atp10a	UTSW	7	58658822	missense	probably damaging	1.00
R8015:Atp10a	UTSW	7	58803497	missense	not run
Z1176:Atp10a	UTSW	7	58788447	critical splice donor site	unknown

Predicted Primers

PCR Primer
(F):5'- CACCAGTGGGGAATGTTTTG -3'
(R):5'- ACTGTTGAATGCTGCGCTGG -3'

Sequencing Primer
(F):5'- CAAAAACCATGTCAAGTCACTTTTG -3'
(R):5'- CGCTGGGTGCTGTGCATG -3'

Posted On

2019-06-07