Incidental Mutation 'PIT4445001:Atp10a'
ID 555408
Institutional Source Beutler Lab
Gene Symbol Atp10a
Ensembl Gene ENSMUSG00000025324
Gene Name ATPase, class V, type 10A
Synonyms Atp10c, pfatp
Accession Numbers
Essential gene? Probably non essential (E-score: 0.133) question?
Stock # PIT4445001 (G1)
Quality Score 170.009
Status Not validated
Chromosome 7
Chromosomal Location 58656166-58829420 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 58803467 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 798 (D798G)
Ref Sequence ENSEMBL: ENSMUSP00000129811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168747]
AlphaFold O54827
Predicted Effect probably damaging
Transcript: ENSMUST00000168747
AA Change: D798G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129811
Gene: ENSMUSG00000025324
AA Change: D798G

DomainStartEndE-ValueType
low complexity region 15 32 N/A INTRINSIC
Pfam:PhoLip_ATPase_N 55 114 5.2e-23 PFAM
Pfam:E1-E2_ATPase 120 393 6.6e-10 PFAM
low complexity region 633 643 N/A INTRINSIC
Pfam:Cation_ATPase 685 791 1.5e-7 PFAM
Pfam:HAD 697 1054 2.1e-12 PFAM
Pfam:PhoLip_ATPase_C 1071 1316 1.1e-76 PFAM
low complexity region 1458 1477 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 90.8%
  • 10x: 84.5%
  • 20x: 70.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. This gene is maternally expressed. It maps within the most common interval of deletion responsible for Angelman syndrome, also known as 'happy puppet syndrome'. [provided by RefSeq, Jul 2008]
PHENOTYPE: Disruption of this gene at the distal end of the p23DFiOD deletion may be responsible for the obesity phenotypes associated with that deletion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,075,551 K419E probably damaging Het
Adam7 T A 14: 68,509,748 K587N possibly damaging Het
Agl T C 3: 116,771,460 M382V Het
Agpat3 A T 10: 78,274,093 F341I possibly damaging Het
Ampd2 A T 3: 108,075,012 L767Q probably damaging Het
Arhgap28 A T 17: 67,896,235 D124E possibly damaging Het
Arhgap32 T C 9: 32,260,856 L1644P probably damaging Het
Asic4 T C 1: 75,451,127 V99A probably benign Het
Asns T A 6: 7,689,277 N75I probably damaging Het
Atp8a1 A G 5: 67,622,660 V1145A Het
BC017158 A G 7: 128,276,534 V243A probably benign Het
Ccdc171 A G 4: 83,661,747 Q577R probably damaging Het
Cd247 T A 1: 165,861,036 D154E probably damaging Het
Ceacam1 A T 7: 25,476,456 N104K probably damaging Het
Chfr A G 5: 110,151,677 D312G possibly damaging Het
Ddb1 C A 19: 10,625,970 L881I probably damaging Het
Dgkh A T 14: 78,575,942 I1032N possibly damaging Het
Efcab6 A T 15: 83,904,267 V942D probably benign Het
Fmo5 A G 3: 97,651,528 T435A probably benign Het
Fpr1 T C 17: 17,876,893 Q278R probably benign Het
Fzr1 C T 10: 81,369,394 W256* probably null Het
Gabrb1 T C 5: 72,108,782 S261P probably damaging Het
Galr2 G T 11: 116,281,648 A55S probably benign Het
Gbp2 A T 3: 142,637,466 K581N probably benign Het
Gm7682 T G 5: 94,448,507 W468G probably benign Het
Gria1 A T 11: 57,185,838 Y89F probably damaging Het
Ibsp T A 5: 104,302,304 I26N possibly damaging Het
Igf1r T C 7: 68,207,463 F1058L probably damaging Het
Ighv1-16 A C 12: 114,666,060 C36G probably benign Het
Igll1 T C 16: 16,860,919 T176A probably benign Het
Ilkap T C 1: 91,385,345 T143A probably benign Het
Kdm3b A T 18: 34,793,115 K103* probably null Het
Mphosph9 A G 5: 124,298,790 I497T possibly damaging Het
Mrgpra3 G A 7: 47,590,160 T6I possibly damaging Het
Mrpl38 T C 11: 116,132,558 probably null Het
Myo3a A T 2: 22,542,415 E813V possibly damaging Het
Myo7b G T 18: 31,959,466 Q2093K possibly damaging Het
Myo7b T C 18: 31,962,352 K1851R probably damaging Het
P3h2 T A 16: 25,984,999 D339V probably benign Het
Pcdhb6 C A 18: 37,335,247 P407Q possibly damaging Het
Plch2 C A 4: 155,009,026 R153L probably damaging Het
Plppr4 G A 3: 117,360,308 probably benign Het
Ppp1r3a A G 6: 14,717,777 F1046S probably damaging Het
Prkacb A T 3: 146,755,691 L107M probably benign Het
Ranbp17 A G 11: 33,481,020 probably null Het
Rasl11b C A 5: 74,197,333 P88Q probably damaging Het
Rcc2 A G 4: 140,721,149 E503G possibly damaging Het
Rnf216 T A 5: 143,086,003 K407N probably damaging Het
Scrn3 G A 2: 73,318,329 M81I possibly damaging Het
Scube2 T C 7: 109,809,180 T687A probably benign Het
Serpinb10 T A 1: 107,535,998 F3L probably benign Het
Sgcb C T 5: 73,639,812 V202I probably damaging Het
Sgce A G 6: 4,689,654 V429A possibly damaging Het
Sh3rf2 T C 18: 42,153,164 V574A probably benign Het
Sncaip T C 18: 52,868,944 L179S probably damaging Het
Sntg2 A T 12: 30,312,572 D58E probably damaging Het
Taar3 T C 10: 23,949,688 I44T possibly damaging Het
Tmem87b G A 2: 128,831,471 V227I probably benign Het
Tnfsf9 T C 17: 57,105,517 L29P possibly damaging Het
Tnip2 T C 5: 34,496,871 H391R probably benign Het
Traf5 A G 1: 191,997,807 Y125H Het
Ttc23 T G 7: 67,667,213 I77M probably damaging Het
Ube2l3 T C 16: 17,160,172 N43S probably benign Het
Vars2 A T 17: 35,666,211 C142* probably null Het
Vmn2r15 A C 5: 109,287,142 D565E probably damaging Het
Vmn2r56 C T 7: 12,715,226 probably null Het
Vmn2r79 A T 7: 87,002,200 D269V possibly damaging Het
Vmn2r85 A T 10: 130,425,703 M255K probably benign Het
Wfdc6a T A 2: 164,579,826 *137C probably null Het
Wipi2 T C 5: 142,666,884 V417A probably benign Het
Xirp2 G T 2: 67,509,772 V786L possibly damaging Het
Zdhhc13 G A 7: 48,795,949 G26S probably benign Het
Zscan25 T A 5: 145,290,612 V362D probably damaging Het
Other mutations in Atp10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00649:Atp10a APN 7 58794482 missense probably benign 0.06
IGL00973:Atp10a APN 7 58807470 missense probably damaging 1.00
IGL00984:Atp10a APN 7 58658741 missense probably damaging 1.00
IGL01086:Atp10a APN 7 58824318 missense probably damaging 0.96
IGL01296:Atp10a APN 7 58813625 missense probably benign 0.02
IGL01731:Atp10a APN 7 58797562 missense probably benign 0.16
IGL02081:Atp10a APN 7 58827856 missense possibly damaging 0.62
IGL02095:Atp10a APN 7 58807393 missense probably damaging 1.00
IGL02549:Atp10a APN 7 58819733 missense probably benign 0.00
IGL02558:Atp10a APN 7 58819642 missense probably damaging 0.98
IGL02659:Atp10a APN 7 58813631 missense probably benign
IGL02986:Atp10a APN 7 58828721 missense probably benign
IGL03218:Atp10a APN 7 58788448 critical splice donor site probably null
PIT4260001:Atp10a UTSW 7 58791118 nonsense probably null
PIT4810001:Atp10a UTSW 7 58813848 missense probably damaging 0.99
R0091:Atp10a UTSW 7 58774046 splice site probably benign
R0349:Atp10a UTSW 7 58803467 missense probably damaging 0.98
R0426:Atp10a UTSW 7 58784734 missense probably benign 0.00
R0609:Atp10a UTSW 7 58819740 splice site probably null
R0722:Atp10a UTSW 7 58816183 missense possibly damaging 0.75
R0741:Atp10a UTSW 7 58828589 missense possibly damaging 0.90
R1172:Atp10a UTSW 7 58803766 missense probably benign 0.05
R1342:Atp10a UTSW 7 58816146 splice site probably benign
R1648:Atp10a UTSW 7 58784827 missense probably damaging 1.00
R1715:Atp10a UTSW 7 58786505 missense probably damaging 0.98
R1737:Atp10a UTSW 7 58827238 splice site probably benign
R1799:Atp10a UTSW 7 58824434 missense probably damaging 1.00
R1909:Atp10a UTSW 7 58828712 missense probably benign 0.12
R1918:Atp10a UTSW 7 58827935 missense possibly damaging 0.82
R2031:Atp10a UTSW 7 58827930 nonsense probably null
R2080:Atp10a UTSW 7 58824327 missense probably damaging 0.97
R2424:Atp10a UTSW 7 58794555 missense probably benign 0.16
R2696:Atp10a UTSW 7 58813618 missense probably benign 0.00
R3932:Atp10a UTSW 7 58827104 missense possibly damaging 0.69
R4198:Atp10a UTSW 7 58813686 missense probably damaging 1.00
R4453:Atp10a UTSW 7 58658500 small deletion probably benign
R4632:Atp10a UTSW 7 58807438 missense possibly damaging 0.48
R4661:Atp10a UTSW 7 58658500 small deletion probably benign
R4782:Atp10a UTSW 7 58791095 missense probably benign
R4888:Atp10a UTSW 7 58785307 missense probably damaging 1.00
R4935:Atp10a UTSW 7 58813764 missense probably damaging 1.00
R5051:Atp10a UTSW 7 58740246 frame shift probably null
R5213:Atp10a UTSW 7 58773983 missense probably damaging 0.99
R5617:Atp10a UTSW 7 58803675 missense probably benign 0.06
R5834:Atp10a UTSW 7 58658618 missense probably benign 0.01
R5885:Atp10a UTSW 7 58813800 missense possibly damaging 0.92
R6013:Atp10a UTSW 7 58797790 missense probably benign 0.05
R6136:Atp10a UTSW 7 58828340 missense probably benign
R6269:Atp10a UTSW 7 58803739 missense possibly damaging 0.51
R6380:Atp10a UTSW 7 58819684 nonsense probably null
R6743:Atp10a UTSW 7 58797814 missense possibly damaging 0.89
R6875:Atp10a UTSW 7 58797352 missense probably benign 0.01
R6975:Atp10a UTSW 7 58773985 missense probably damaging 1.00
R7082:Atp10a UTSW 7 58658819 missense probably damaging 1.00
R7203:Atp10a UTSW 7 58786473 missense probably benign
R7224:Atp10a UTSW 7 58797471 missense probably benign 0.00
R7287:Atp10a UTSW 7 58827269 missense probably damaging 1.00
R7437:Atp10a UTSW 7 58658540 missense unknown
R7474:Atp10a UTSW 7 58658527 missense unknown
R7530:Atp10a UTSW 7 58773976 missense probably benign 0.02
R7561:Atp10a UTSW 7 58827133 missense probably damaging 0.98
R7743:Atp10a UTSW 7 58803709 missense probably damaging 1.00
R7767:Atp10a UTSW 7 58658849 missense probably damaging 1.00
R7861:Atp10a UTSW 7 58788359 missense probably damaging 1.00
R7903:Atp10a UTSW 7 58658822 missense probably damaging 1.00
R8015:Atp10a UTSW 7 58803497 missense probably benign 0.00
R8166:Atp10a UTSW 7 58807522 missense possibly damaging 0.46
R8201:Atp10a UTSW 7 58819676 nonsense probably null
R8465:Atp10a UTSW 7 58828310 missense probably benign 0.32
R8858:Atp10a UTSW 7 58816223 missense probably damaging 1.00
R8985:Atp10a UTSW 7 58788344 missense probably benign 0.03
R9003:Atp10a UTSW 7 58807455 missense probably damaging 1.00
R9274:Atp10a UTSW 7 58828621 missense probably benign 0.22
R9385:Atp10a UTSW 7 58828139 missense probably benign 0.00
R9432:Atp10a UTSW 7 58819670 missense possibly damaging 0.95
R9454:Atp10a UTSW 7 58658591 missense probably benign
R9596:Atp10a UTSW 7 58827805 missense probably damaging 1.00
R9736:Atp10a UTSW 7 58824330 missense probably damaging 1.00
Z1176:Atp10a UTSW 7 58788447 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CACCAGTGGGGAATGTTTTG -3'
(R):5'- ACTGTTGAATGCTGCGCTGG -3'

Sequencing Primer
(F):5'- CAAAAACCATGTCAAGTCACTTTTG -3'
(R):5'- CGCTGGGTGCTGTGCATG -3'
Posted On 2019-06-07