Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4445001:Atp10a'

555408

Institutional Source

Beutler Lab

Gene Symbol

Atp10a

Ensembl Gene

ENSMUSG00000025324

Gene Name

ATPase, class V, type 10A

Synonyms

Atp10c, pfatp

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.133) question?

Stock #

PIT4445001 (G1)

Quality Score

170.009

Status

Not validated

Chromosome

Chromosomal Location

58656166-58829420 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 58803467 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 798 (D798G)

Ref Sequence

ENSEMBL: ENSMUSP00000129811 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168747]

AlphaFold

O54827

Predicted Effect

probably damaging
Transcript: ENSMUST00000168747
AA Change: D798G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000129811
Gene: ENSMUSG00000025324
AA Change: D798G

Domain	Start	End	E-Value	Type
low complexity region	15	32	N/A	INTRINSIC
Pfam:PhoLip_ATPase_N	55	114	5.2e-23	PFAM
Pfam:E1-E2_ATPase	120	393	6.6e-10	PFAM
low complexity region	633	643	N/A	INTRINSIC
Pfam:Cation_ATPase	685	791	1.5e-7	PFAM
Pfam:HAD	697	1054	2.1e-12	PFAM
Pfam:PhoLip_ATPase_C	1071	1316	1.1e-76	PFAM
low complexity region	1458	1477	N/A	INTRINSIC

Coding Region Coverage

1x: 93.5%
3x: 90.8%
10x: 84.5%
20x: 70.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. This gene is maternally expressed. It maps within the most common interval of deletion responsible for Angelman syndrome, also known as 'happy puppet syndrome'. [provided by RefSeq, Jul 2008]
PHENOTYPE: Disruption of this gene at the distal end of the p^23DFiOD deletion may be responsible for the obesity phenotypes associated with that deletion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8a	T	C	11: 110,075,551	K419E	probably damaging	Het
Adam7	T	A	14: 68,509,748	K587N	possibly damaging	Het
Agl	T	C	3: 116,771,460	M382V		Het
Agpat3	A	T	10: 78,274,093	F341I	possibly damaging	Het
Ampd2	A	T	3: 108,075,012	L767Q	probably damaging	Het
Arhgap28	A	T	17: 67,896,235	D124E	possibly damaging	Het
Arhgap32	T	C	9: 32,260,856	L1644P	probably damaging	Het
Asic4	T	C	1: 75,451,127	V99A	probably benign	Het
Asns	T	A	6: 7,689,277	N75I	probably damaging	Het
Atp8a1	A	G	5: 67,622,660	V1145A		Het
BC017158	A	G	7: 128,276,534	V243A	probably benign	Het
Ccdc171	A	G	4: 83,661,747	Q577R	probably damaging	Het
Cd247	T	A	1: 165,861,036	D154E	probably damaging	Het
Ceacam1	A	T	7: 25,476,456	N104K	probably damaging	Het
Chfr	A	G	5: 110,151,677	D312G	possibly damaging	Het
Ddb1	C	A	19: 10,625,970	L881I	probably damaging	Het
Dgkh	A	T	14: 78,575,942	I1032N	possibly damaging	Het
Efcab6	A	T	15: 83,904,267	V942D	probably benign	Het
Fmo5	A	G	3: 97,651,528	T435A	probably benign	Het
Fpr1	T	C	17: 17,876,893	Q278R	probably benign	Het
Fzr1	C	T	10: 81,369,394	W256*	probably null	Het
Gabrb1	T	C	5: 72,108,782	S261P	probably damaging	Het
Galr2	G	T	11: 116,281,648	A55S	probably benign	Het
Gbp2	A	T	3: 142,637,466	K581N	probably benign	Het
Gm7682	T	G	5: 94,448,507	W468G	probably benign	Het
Gria1	A	T	11: 57,185,838	Y89F	probably damaging	Het
Ibsp	T	A	5: 104,302,304	I26N	possibly damaging	Het
Igf1r	T	C	7: 68,207,463	F1058L	probably damaging	Het
Ighv1-16	A	C	12: 114,666,060	C36G	probably benign	Het
Igll1	T	C	16: 16,860,919	T176A	probably benign	Het
Ilkap	T	C	1: 91,385,345	T143A	probably benign	Het
Kdm3b	A	T	18: 34,793,115	K103*	probably null	Het
Mphosph9	A	G	5: 124,298,790	I497T	possibly damaging	Het
Mrgpra3	G	A	7: 47,590,160	T6I	possibly damaging	Het
Mrpl38	T	C	11: 116,132,558		probably null	Het
Myo3a	A	T	2: 22,542,415	E813V	possibly damaging	Het
Myo7b	G	T	18: 31,959,466	Q2093K	possibly damaging	Het
Myo7b	T	C	18: 31,962,352	K1851R	probably damaging	Het
P3h2	T	A	16: 25,984,999	D339V	probably benign	Het
Pcdhb6	C	A	18: 37,335,247	P407Q	possibly damaging	Het
Plch2	C	A	4: 155,009,026	R153L	probably damaging	Het
Plppr4	G	A	3: 117,360,308		probably benign	Het
Ppp1r3a	A	G	6: 14,717,777	F1046S	probably damaging	Het
Prkacb	A	T	3: 146,755,691	L107M	probably benign	Het
Ranbp17	A	G	11: 33,481,020		probably null	Het
Rasl11b	C	A	5: 74,197,333	P88Q	probably damaging	Het
Rcc2	A	G	4: 140,721,149	E503G	possibly damaging	Het
Rnf216	T	A	5: 143,086,003	K407N	probably damaging	Het
Scrn3	G	A	2: 73,318,329	M81I	possibly damaging	Het
Scube2	T	C	7: 109,809,180	T687A	probably benign	Het
Serpinb10	T	A	1: 107,535,998	F3L	probably benign	Het
Sgcb	C	T	5: 73,639,812	V202I	probably damaging	Het
Sgce	A	G	6: 4,689,654	V429A	possibly damaging	Het
Sh3rf2	T	C	18: 42,153,164	V574A	probably benign	Het
Sncaip	T	C	18: 52,868,944	L179S	probably damaging	Het
Sntg2	A	T	12: 30,312,572	D58E	probably damaging	Het
Taar3	T	C	10: 23,949,688	I44T	possibly damaging	Het
Tmem87b	G	A	2: 128,831,471	V227I	probably benign	Het
Tnfsf9	T	C	17: 57,105,517	L29P	possibly damaging	Het
Tnip2	T	C	5: 34,496,871	H391R	probably benign	Het
Traf5	A	G	1: 191,997,807	Y125H		Het
Ttc23	T	G	7: 67,667,213	I77M	probably damaging	Het
Ube2l3	T	C	16: 17,160,172	N43S	probably benign	Het
Vars2	A	T	17: 35,666,211	C142*	probably null	Het
Vmn2r15	A	C	5: 109,287,142	D565E	probably damaging	Het
Vmn2r56	C	T	7: 12,715,226		probably null	Het
Vmn2r79	A	T	7: 87,002,200	D269V	possibly damaging	Het
Vmn2r85	A	T	10: 130,425,703	M255K	probably benign	Het
Wfdc6a	T	A	2: 164,579,826	*137C	probably null	Het
Wipi2	T	C	5: 142,666,884	V417A	probably benign	Het
Xirp2	G	T	2: 67,509,772	V786L	possibly damaging	Het
Zdhhc13	G	A	7: 48,795,949	G26S	probably benign	Het
Zscan25	T	A	5: 145,290,612	V362D	probably damaging	Het

Other mutations in Atp10a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00649:Atp10a	APN	7	58794482	missense	probably benign	0.06
IGL00973:Atp10a	APN	7	58807470	missense	probably damaging	1.00
IGL00984:Atp10a	APN	7	58658741	missense	probably damaging	1.00
IGL01086:Atp10a	APN	7	58824318	missense	probably damaging	0.96
IGL01296:Atp10a	APN	7	58813625	missense	probably benign	0.02
IGL01731:Atp10a	APN	7	58797562	missense	probably benign	0.16
IGL02081:Atp10a	APN	7	58827856	missense	possibly damaging	0.62
IGL02095:Atp10a	APN	7	58807393	missense	probably damaging	1.00
IGL02549:Atp10a	APN	7	58819733	missense	probably benign	0.00
IGL02558:Atp10a	APN	7	58819642	missense	probably damaging	0.98
IGL02659:Atp10a	APN	7	58813631	missense	probably benign
IGL02986:Atp10a	APN	7	58828721	missense	probably benign
IGL03218:Atp10a	APN	7	58788448	critical splice donor site	probably null
PIT4260001:Atp10a	UTSW	7	58791118	nonsense	probably null
PIT4810001:Atp10a	UTSW	7	58813848	missense	probably damaging	0.99
R0091:Atp10a	UTSW	7	58774046	splice site	probably benign
R0349:Atp10a	UTSW	7	58803467	missense	probably damaging	0.98
R0426:Atp10a	UTSW	7	58784734	missense	probably benign	0.00
R0609:Atp10a	UTSW	7	58819740	splice site	probably null
R0722:Atp10a	UTSW	7	58816183	missense	possibly damaging	0.75
R0741:Atp10a	UTSW	7	58828589	missense	possibly damaging	0.90
R1172:Atp10a	UTSW	7	58803766	missense	probably benign	0.05
R1342:Atp10a	UTSW	7	58816146	splice site	probably benign
R1648:Atp10a	UTSW	7	58784827	missense	probably damaging	1.00
R1715:Atp10a	UTSW	7	58786505	missense	probably damaging	0.98
R1737:Atp10a	UTSW	7	58827238	splice site	probably benign
R1799:Atp10a	UTSW	7	58824434	missense	probably damaging	1.00
R1909:Atp10a	UTSW	7	58828712	missense	probably benign	0.12
R1918:Atp10a	UTSW	7	58827935	missense	possibly damaging	0.82
R2031:Atp10a	UTSW	7	58827930	nonsense	probably null
R2080:Atp10a	UTSW	7	58824327	missense	probably damaging	0.97
R2424:Atp10a	UTSW	7	58794555	missense	probably benign	0.16
R2696:Atp10a	UTSW	7	58813618	missense	probably benign	0.00
R3932:Atp10a	UTSW	7	58827104	missense	possibly damaging	0.69
R4198:Atp10a	UTSW	7	58813686	missense	probably damaging	1.00
R4453:Atp10a	UTSW	7	58658500	small deletion	probably benign
R4632:Atp10a	UTSW	7	58807438	missense	possibly damaging	0.48
R4661:Atp10a	UTSW	7	58658500	small deletion	probably benign
R4782:Atp10a	UTSW	7	58791095	missense	probably benign
R4888:Atp10a	UTSW	7	58785307	missense	probably damaging	1.00
R4935:Atp10a	UTSW	7	58813764	missense	probably damaging	1.00
R5051:Atp10a	UTSW	7	58740246	frame shift	probably null
R5213:Atp10a	UTSW	7	58773983	missense	probably damaging	0.99
R5617:Atp10a	UTSW	7	58803675	missense	probably benign	0.06
R5834:Atp10a	UTSW	7	58658618	missense	probably benign	0.01
R5885:Atp10a	UTSW	7	58813800	missense	possibly damaging	0.92
R6013:Atp10a	UTSW	7	58797790	missense	probably benign	0.05
R6136:Atp10a	UTSW	7	58828340	missense	probably benign
R6269:Atp10a	UTSW	7	58803739	missense	possibly damaging	0.51
R6380:Atp10a	UTSW	7	58819684	nonsense	probably null
R6743:Atp10a	UTSW	7	58797814	missense	possibly damaging	0.89
R6875:Atp10a	UTSW	7	58797352	missense	probably benign	0.01
R6975:Atp10a	UTSW	7	58773985	missense	probably damaging	1.00
R7082:Atp10a	UTSW	7	58658819	missense	probably damaging	1.00
R7203:Atp10a	UTSW	7	58786473	missense	probably benign
R7224:Atp10a	UTSW	7	58797471	missense	probably benign	0.00
R7287:Atp10a	UTSW	7	58827269	missense	probably damaging	1.00
R7437:Atp10a	UTSW	7	58658540	missense	unknown
R7474:Atp10a	UTSW	7	58658527	missense	unknown
R7530:Atp10a	UTSW	7	58773976	missense	probably benign	0.02
R7561:Atp10a	UTSW	7	58827133	missense	probably damaging	0.98
R7743:Atp10a	UTSW	7	58803709	missense	probably damaging	1.00
R7767:Atp10a	UTSW	7	58658849	missense	probably damaging	1.00
R7861:Atp10a	UTSW	7	58788359	missense	probably damaging	1.00
R7903:Atp10a	UTSW	7	58658822	missense	probably damaging	1.00
R8015:Atp10a	UTSW	7	58803497	missense	probably benign	0.00
R8166:Atp10a	UTSW	7	58807522	missense	possibly damaging	0.46
R8201:Atp10a	UTSW	7	58819676	nonsense	probably null
R8465:Atp10a	UTSW	7	58828310	missense	probably benign	0.32
R8858:Atp10a	UTSW	7	58816223	missense	probably damaging	1.00
R8985:Atp10a	UTSW	7	58788344	missense	probably benign	0.03
R9003:Atp10a	UTSW	7	58807455	missense	probably damaging	1.00
R9274:Atp10a	UTSW	7	58828621	missense	probably benign	0.22
R9385:Atp10a	UTSW	7	58828139	missense	probably benign	0.00
R9432:Atp10a	UTSW	7	58819670	missense	possibly damaging	0.95
R9454:Atp10a	UTSW	7	58658591	missense	probably benign
R9596:Atp10a	UTSW	7	58827805	missense	probably damaging	1.00
R9736:Atp10a	UTSW	7	58824330	missense	probably damaging	1.00
Z1176:Atp10a	UTSW	7	58788447	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- CACCAGTGGGGAATGTTTTG -3'
(R):5'- ACTGTTGAATGCTGCGCTGG -3'

Sequencing Primer
(F):5'- CAAAAACCATGTCAAGTCACTTTTG -3'
(R):5'- CGCTGGGTGCTGTGCATG -3'

Posted On

2019-06-07