Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4445001:Igf1r'

555410

Institutional Source

Beutler Lab

Gene Symbol

Igf1r

Ensembl Gene

ENSMUSG00000005533

Gene Name

insulin-like growth factor I receptor

Synonyms

line 186, A330103N21Rik, CD221, hyft, IGF-1R

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

PIT4445001 (G1)

Quality Score

158.009

Status

Not validated

Chromosome

Chromosomal Location

67952827-68233668 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 68207463 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 1058 (F1058L)

Ref Sequence

ENSEMBL: ENSMUSP00000005671 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005671]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000005671
AA Change: F1058L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000005671
Gene: ENSMUSG00000005533
AA Change: F1058L

Domain	Start	End	E-Value	Type
Pfam:Recep_L_domain	51	161	1.6e-29	PFAM
FU	227	270	2.98e-12	SMART
Pfam:Recep_L_domain	353	467	3.8e-32	PFAM
FN3	490	593	4.67e-2	SMART
FN3	612	815	1.95e-4	SMART
FN3	833	915	7.4e-5	SMART
low complexity region	937	954	N/A	INTRINSIC
TyrKc	1000	1268	8.51e-141	SMART
low complexity region	1285	1303	N/A	INTRINSIC
low complexity region	1306	1319	N/A	INTRINSIC

Coding Region Coverage

1x: 93.5%
3x: 90.8%
10x: 84.5%
20x: 70.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This receptor binds insulin-like growth factor with a high affinity. It has tyrosine kinase activity. The insulin-like growth factor I receptor plays a critical role in transformation events. Cleavage of the precursor generates alpha and beta subunits. It is highly overexpressed in most malignant tissues where it functions as an anti-apoptotic agent by enhancing cell survival. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Targeted null mutants die at birth of respiratory failure; fetuses exhibit retarded growth, organ hypoplasia, ossification delay and nervous system and epidermal abnormalities. hyft homozygous fetuses are growth retarded and exhibit hydrops fetalis and focal hepatic ischemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8a	T	C	11: 110,075,551	K419E	probably damaging	Het
Adam7	T	A	14: 68,509,748	K587N	possibly damaging	Het
Agl	T	C	3: 116,771,460	M382V		Het
Agpat3	A	T	10: 78,274,093	F341I	possibly damaging	Het
Ampd2	A	T	3: 108,075,012	L767Q	probably damaging	Het
Arhgap28	A	T	17: 67,896,235	D124E	possibly damaging	Het
Arhgap32	T	C	9: 32,260,856	L1644P	probably damaging	Het
Asic4	T	C	1: 75,451,127	V99A	probably benign	Het
Asns	T	A	6: 7,689,277	N75I	probably damaging	Het
Atp10a	A	G	7: 58,803,467	D798G	probably damaging	Het
Atp8a1	A	G	5: 67,622,660	V1145A		Het
BC017158	A	G	7: 128,276,534	V243A	probably benign	Het
Ccdc171	A	G	4: 83,661,747	Q577R	probably damaging	Het
Cd247	T	A	1: 165,861,036	D154E	probably damaging	Het
Ceacam1	A	T	7: 25,476,456	N104K	probably damaging	Het
Chfr	A	G	5: 110,151,677	D312G	possibly damaging	Het
Ddb1	C	A	19: 10,625,970	L881I	probably damaging	Het
Dgkh	A	T	14: 78,575,942	I1032N	possibly damaging	Het
Efcab6	A	T	15: 83,904,267	V942D	probably benign	Het
Fmo5	A	G	3: 97,651,528	T435A	probably benign	Het
Fpr1	T	C	17: 17,876,893	Q278R	probably benign	Het
Fzr1	C	T	10: 81,369,394	W256*	probably null	Het
Gabrb1	T	C	5: 72,108,782	S261P	probably damaging	Het
Galr2	G	T	11: 116,281,648	A55S	probably benign	Het
Gbp2	A	T	3: 142,637,466	K581N	probably benign	Het
Gm7682	T	G	5: 94,448,507	W468G	probably benign	Het
Gria1	A	T	11: 57,185,838	Y89F	probably damaging	Het
Ibsp	T	A	5: 104,302,304	I26N	possibly damaging	Het
Ighv1-16	A	C	12: 114,666,060	C36G	probably benign	Het
Igll1	T	C	16: 16,860,919	T176A	probably benign	Het
Ilkap	T	C	1: 91,385,345	T143A	probably benign	Het
Kdm3b	A	T	18: 34,793,115	K103*	probably null	Het
Mphosph9	A	G	5: 124,298,790	I497T	possibly damaging	Het
Mrgpra3	G	A	7: 47,590,160	T6I	possibly damaging	Het
Mrpl38	T	C	11: 116,132,558		probably null	Het
Myo3a	A	T	2: 22,542,415	E813V	possibly damaging	Het
Myo7b	G	T	18: 31,959,466	Q2093K	possibly damaging	Het
Myo7b	T	C	18: 31,962,352	K1851R	probably damaging	Het
P3h2	T	A	16: 25,984,999	D339V	probably benign	Het
Pcdhb6	C	A	18: 37,335,247	P407Q	possibly damaging	Het
Plch2	C	A	4: 155,009,026	R153L	probably damaging	Het
Plppr4	G	A	3: 117,360,308		probably benign	Het
Ppp1r3a	A	G	6: 14,717,777	F1046S	probably damaging	Het
Prkacb	A	T	3: 146,755,691	L107M	probably benign	Het
Ranbp17	A	G	11: 33,481,020		probably null	Het
Rasl11b	C	A	5: 74,197,333	P88Q	probably damaging	Het
Rcc2	A	G	4: 140,721,149	E503G	possibly damaging	Het
Rnf216	T	A	5: 143,086,003	K407N	probably damaging	Het
Scrn3	G	A	2: 73,318,329	M81I	possibly damaging	Het
Scube2	T	C	7: 109,809,180	T687A	probably benign	Het
Serpinb10	T	A	1: 107,535,998	F3L	probably benign	Het
Sgcb	C	T	5: 73,639,812	V202I	probably damaging	Het
Sgce	A	G	6: 4,689,654	V429A	possibly damaging	Het
Sh3rf2	T	C	18: 42,153,164	V574A	probably benign	Het
Sncaip	T	C	18: 52,868,944	L179S	probably damaging	Het
Sntg2	A	T	12: 30,312,572	D58E	probably damaging	Het
Taar3	T	C	10: 23,949,688	I44T	possibly damaging	Het
Tmem87b	G	A	2: 128,831,471	V227I	probably benign	Het
Tnfsf9	T	C	17: 57,105,517	L29P	possibly damaging	Het
Tnip2	T	C	5: 34,496,871	H391R	probably benign	Het
Traf5	A	G	1: 191,997,807	Y125H		Het
Ttc23	T	G	7: 67,667,213	I77M	probably damaging	Het
Ube2l3	T	C	16: 17,160,172	N43S	probably benign	Het
Vars2	A	T	17: 35,666,211	C142*	probably null	Het
Vmn2r15	A	C	5: 109,287,142	D565E	probably damaging	Het
Vmn2r56	C	T	7: 12,715,226		probably null	Het
Vmn2r79	A	T	7: 87,002,200	D269V	possibly damaging	Het
Vmn2r85	A	T	10: 130,425,703	M255K	probably benign	Het
Wfdc6a	T	A	2: 164,579,826	*137C	probably null	Het
Wipi2	T	C	5: 142,666,884	V417A	probably benign	Het
Xirp2	G	T	2: 67,509,772	V786L	possibly damaging	Het
Zdhhc13	G	A	7: 48,795,949	G26S	probably benign	Het
Zscan25	T	A	5: 145,290,612	V362D	probably damaging	Het

Other mutations in Igf1r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00742:Igf1r	APN	7	68190023	missense	probably benign
IGL00837:Igf1r	APN	7	68201352	splice site	probably benign
IGL01515:Igf1r	APN	7	68207452	missense	probably damaging	1.00
IGL01572:Igf1r	APN	7	68193441	missense	probably benign	0.01
IGL02100:Igf1r	APN	7	68189958	missense	probably benign	0.05
IGL02506:Igf1r	APN	7	68193396	missense	probably benign
IGL02672:Igf1r	APN	7	68190033	missense	probably benign	0.05
IGL02701:Igf1r	APN	7	68201249	missense	possibly damaging	0.93
IGL02742:Igf1r	APN	7	68189991	missense	possibly damaging	0.94
IGL03073:Igf1r	APN	7	68215043	missense	probably damaging	1.00
IGL03257:Igf1r	APN	7	68214940	missense	probably damaging	1.00
Frufru	UTSW	7	68004163	missense	probably damaging	1.00
Hungarian	UTSW	7	68214997	missense	probably damaging	1.00
Mimi	UTSW	7	68195026	missense	possibly damaging	0.67
Piroshka	UTSW	7	68207336	nonsense	probably null
Romanian	UTSW	7	68004137	missense	possibly damaging	0.94
Sublime	UTSW	7	68004179	missense	probably damaging	1.00
Toy	UTSW	7	68003972	missense	probably damaging	1.00
BB009:Igf1r	UTSW	7	68212054	missense	possibly damaging	0.88
BB019:Igf1r	UTSW	7	68212054	missense	possibly damaging	0.88
FR4548:Igf1r	UTSW	7	68226186	small insertion	probably benign
FR4737:Igf1r	UTSW	7	68226181	small insertion	probably benign
FR4976:Igf1r	UTSW	7	68226181	small insertion	probably benign
FR4976:Igf1r	UTSW	7	68226186	small insertion	probably benign
R0003:Igf1r	UTSW	7	68165242	missense	probably damaging	1.00
R0184:Igf1r	UTSW	7	68226193	missense	possibly damaging	0.84
R0538:Igf1r	UTSW	7	68207826	missense	probably damaging	1.00
R0632:Igf1r	UTSW	7	68165155	missense	probably damaging	1.00
R0727:Igf1r	UTSW	7	68212158	critical splice donor site	probably null
R0750:Igf1r	UTSW	7	68212091	missense	probably damaging	0.99
R1104:Igf1r	UTSW	7	68195026	missense	possibly damaging	0.67
R1169:Igf1r	UTSW	7	68165127	missense	probably benign	0.00
R1348:Igf1r	UTSW	7	68218468	missense	probably damaging	1.00
R1471:Igf1r	UTSW	7	68003837	missense	probably damaging	0.98
R1580:Igf1r	UTSW	7	68207869	missense	probably benign
R1745:Igf1r	UTSW	7	68169913	missense	probably damaging	1.00
R1772:Igf1r	UTSW	7	68195074	missense	probably benign	0.03
R1789:Igf1r	UTSW	7	68214933	nonsense	probably null
R1823:Igf1r	UTSW	7	68194981	missense	possibly damaging	0.77
R1902:Igf1r	UTSW	7	68201249	missense	possibly damaging	0.93
R1962:Igf1r	UTSW	7	68207275	missense	probably damaging	0.99
R2179:Igf1r	UTSW	7	68003950	missense	probably damaging	0.99
R2215:Igf1r	UTSW	7	68165234	missense	probably benign
R2221:Igf1r	UTSW	7	68201962	missense	probably damaging	1.00
R2233:Igf1r	UTSW	7	68212080	missense	probably damaging	1.00
R2234:Igf1r	UTSW	7	68212080	missense	probably damaging	1.00
R2235:Igf1r	UTSW	7	68212080	missense	probably damaging	1.00
R3023:Igf1r	UTSW	7	68183399	missense	probably benign	0.00
R4044:Igf1r	UTSW	7	68190062	missense	possibly damaging	0.83
R4226:Igf1r	UTSW	7	68195078	nonsense	probably null
R4387:Igf1r	UTSW	7	68170009	missense	probably benign
R4388:Igf1r	UTSW	7	68170009	missense	probably benign
R4728:Igf1r	UTSW	7	68189624	missense	probably damaging	1.00
R4781:Igf1r	UTSW	7	68165199	missense	possibly damaging	0.75
R5254:Igf1r	UTSW	7	68207319	missense	probably damaging	0.99
R5278:Igf1r	UTSW	7	68193418	missense	possibly damaging	0.78
R5510:Igf1r	UTSW	7	68193359	missense	probably benign	0.19
R5522:Igf1r	UTSW	7	68183510	missense	probably damaging	0.96
R5527:Igf1r	UTSW	7	68207821	missense	probably damaging	1.00
R5761:Igf1r	UTSW	7	68207253	missense	probably damaging	1.00
R5849:Igf1r	UTSW	7	68190033	missense	probably benign
R6189:Igf1r	UTSW	7	68207336	nonsense	probably null
R6262:Igf1r	UTSW	7	68003972	missense	probably damaging	1.00
R6285:Igf1r	UTSW	7	68004137	missense	possibly damaging	0.94
R6318:Igf1r	UTSW	7	68165233	missense	probably benign	0.02
R6365:Igf1r	UTSW	7	68190050	missense	probably benign	0.26
R6377:Igf1r	UTSW	7	68201250	missense	probably benign	0.00
R6831:Igf1r	UTSW	7	68207319	missense	possibly damaging	0.75
R6848:Igf1r	UTSW	7	68004179	missense	probably damaging	1.00
R6902:Igf1r	UTSW	7	68004163	missense	probably damaging	1.00
R7193:Igf1r	UTSW	7	68187157	missense	probably damaging	1.00
R7373:Igf1r	UTSW	7	68195078	nonsense	probably null
R7442:Igf1r	UTSW	7	68173278	missense	probably damaging	1.00
R7903:Igf1r	UTSW	7	68184752	missense	probably damaging	1.00
R7923:Igf1r	UTSW	7	68190101	missense	probably damaging	1.00
R7932:Igf1r	UTSW	7	68212054	missense	possibly damaging	0.88
R8368:Igf1r	UTSW	7	68187048	missense	probably benign	0.03
R8458:Igf1r	UTSW	7	68195629	missense	probably benign
R8539:Igf1r	UTSW	7	68003848	missense	probably benign	0.06
R8704:Igf1r	UTSW	7	68170054	splice site	probably benign
R8746:Igf1r	UTSW	7	68214997	missense	probably damaging	1.00
R8829:Igf1r	UTSW	7	68226021	missense	probably damaging	1.00
R8832:Igf1r	UTSW	7	68226021	missense	probably damaging	1.00
R8859:Igf1r	UTSW	7	68183463	missense	possibly damaging	0.75
R9057:Igf1r	UTSW	7	68183438	missense	probably damaging	1.00
R9243:Igf1r	UTSW	7	68212027	missense	probably benign	0.11
R9342:Igf1r	UTSW	7	68194998	missense	probably benign	0.00
R9412:Igf1r	UTSW	7	68207253	missense	probably damaging	1.00
R9525:Igf1r	UTSW	7	68214934	missense	probably damaging	1.00
RF025:Igf1r	UTSW	7	68226179	small insertion	probably benign
RF032:Igf1r	UTSW	7	68226179	small insertion	probably benign
RF034:Igf1r	UTSW	7	68226176	small insertion	probably benign
RF037:Igf1r	UTSW	7	68226176	small insertion	probably benign
RF039:Igf1r	UTSW	7	68226176	small insertion	probably benign
RF044:Igf1r	UTSW	7	68226179	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226168	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226169	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226174	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226180	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226182	small insertion	probably benign
Z1191:Igf1r	UTSW	7	68226169	small insertion	probably benign
Z1191:Igf1r	UTSW	7	68226170	small insertion	probably benign
Z1191:Igf1r	UTSW	7	68226173	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- AAGATCACCATGAACCGGG -3'
(R):5'- CACATGATGACCTACGCCTC -3'

Sequencing Primer
(F):5'- TCACCATGAACCGGGAGCTC -3'
(R):5'- GATGACCTACGCCTCTCGGAAC -3'

Posted On

2019-06-07