Incidental Mutation 'PIT4445001:Vmn2r79'
ID 555411
Institutional Source Beutler Lab
Gene Symbol Vmn2r79
Ensembl Gene ENSMUSG00000090362
Gene Name vomeronasal 2, receptor 79
Synonyms EG621430
Accession Numbers
Essential gene? Probably non essential (E-score: 0.093) question?
Stock # PIT4445001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 86996465-87037968 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 87002200 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 269 (D269V)
Ref Sequence ENSEMBL: ENSMUSP00000132478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164462]
AlphaFold E9Q067
Predicted Effect possibly damaging
Transcript: ENSMUST00000164462
AA Change: D269V

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132478
Gene: ENSMUSG00000090362
AA Change: D269V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 75 464 1.9e-31 PFAM
Pfam:NCD3G 506 559 3.1e-21 PFAM
Pfam:7tm_3 592 827 2.8e-53 PFAM
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 90.8%
  • 10x: 84.5%
  • 20x: 70.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,075,551 (GRCm38) K419E probably damaging Het
Adam7 T A 14: 68,509,748 (GRCm38) K587N possibly damaging Het
Agl T C 3: 116,771,460 (GRCm38) M382V Het
Agpat3 A T 10: 78,274,093 (GRCm38) F341I possibly damaging Het
Ampd2 A T 3: 108,075,012 (GRCm38) L767Q probably damaging Het
Arhgap28 A T 17: 67,896,235 (GRCm38) D124E possibly damaging Het
Arhgap32 T C 9: 32,260,856 (GRCm38) L1644P probably damaging Het
Asic4 T C 1: 75,451,127 (GRCm38) V99A probably benign Het
Asns T A 6: 7,689,277 (GRCm38) N75I probably damaging Het
Atp10a A G 7: 58,803,467 (GRCm38) D798G probably damaging Het
Atp8a1 A G 5: 67,622,660 (GRCm38) V1145A Het
BC017158 A G 7: 128,276,534 (GRCm38) V243A probably benign Het
Ccdc171 A G 4: 83,661,747 (GRCm38) Q577R probably damaging Het
Cd247 T A 1: 165,861,036 (GRCm38) D154E probably damaging Het
Ceacam1 A T 7: 25,476,456 (GRCm38) N104K probably damaging Het
Chfr A G 5: 110,151,677 (GRCm38) D312G possibly damaging Het
Ddb1 C A 19: 10,625,970 (GRCm38) L881I probably damaging Het
Dgkh A T 14: 78,575,942 (GRCm38) I1032N possibly damaging Het
Efcab6 A T 15: 83,904,267 (GRCm38) V942D probably benign Het
Fmo5 A G 3: 97,651,528 (GRCm38) T435A probably benign Het
Fpr1 T C 17: 17,876,893 (GRCm38) Q278R probably benign Het
Fzr1 C T 10: 81,369,394 (GRCm38) W256* probably null Het
Gabrb1 T C 5: 72,108,782 (GRCm38) S261P probably damaging Het
Galr2 G T 11: 116,281,648 (GRCm38) A55S probably benign Het
Gbp2 A T 3: 142,637,466 (GRCm38) K581N probably benign Het
Gm7682 T G 5: 94,448,507 (GRCm38) W468G probably benign Het
Gria1 A T 11: 57,185,838 (GRCm38) Y89F probably damaging Het
Ibsp T A 5: 104,302,304 (GRCm38) I26N possibly damaging Het
Igf1r T C 7: 68,207,463 (GRCm38) F1058L probably damaging Het
Ighv1-16 A C 12: 114,666,060 (GRCm38) C36G probably benign Het
Igll1 T C 16: 16,860,919 (GRCm38) T176A probably benign Het
Ilkap T C 1: 91,385,345 (GRCm38) T143A probably benign Het
Kdm3b A T 18: 34,793,115 (GRCm38) K103* probably null Het
Mphosph9 A G 5: 124,298,790 (GRCm38) I497T possibly damaging Het
Mrgpra3 G A 7: 47,590,160 (GRCm38) T6I possibly damaging Het
Mrpl38 T C 11: 116,132,558 (GRCm38) probably null Het
Myo3a A T 2: 22,542,415 (GRCm38) E813V possibly damaging Het
Myo7b G T 18: 31,959,466 (GRCm38) Q2093K possibly damaging Het
Myo7b T C 18: 31,962,352 (GRCm38) K1851R probably damaging Het
P3h2 T A 16: 25,984,999 (GRCm38) D339V probably benign Het
Pcdhb6 C A 18: 37,335,247 (GRCm38) P407Q possibly damaging Het
Plch2 C A 4: 155,009,026 (GRCm38) R153L probably damaging Het
Plppr4 G A 3: 117,360,308 (GRCm38) probably benign Het
Ppp1r3a A G 6: 14,717,777 (GRCm38) F1046S probably damaging Het
Prkacb A T 3: 146,755,691 (GRCm38) L107M probably benign Het
Ranbp17 A G 11: 33,481,020 (GRCm38) probably null Het
Rasl11b C A 5: 74,197,333 (GRCm38) P88Q probably damaging Het
Rcc2 A G 4: 140,721,149 (GRCm38) E503G possibly damaging Het
Rnf216 T A 5: 143,086,003 (GRCm38) K407N probably damaging Het
Scrn3 G A 2: 73,318,329 (GRCm38) M81I possibly damaging Het
Scube2 T C 7: 109,809,180 (GRCm38) T687A probably benign Het
Serpinb10 T A 1: 107,535,998 (GRCm38) F3L probably benign Het
Sgcb C T 5: 73,639,812 (GRCm38) V202I probably damaging Het
Sgce A G 6: 4,689,654 (GRCm38) V429A possibly damaging Het
Sh3rf2 T C 18: 42,153,164 (GRCm38) V574A probably benign Het
Sncaip T C 18: 52,868,944 (GRCm38) L179S probably damaging Het
Sntg2 A T 12: 30,312,572 (GRCm38) D58E probably damaging Het
Taar3 T C 10: 23,949,688 (GRCm38) I44T possibly damaging Het
Tmem87b G A 2: 128,831,471 (GRCm38) V227I probably benign Het
Tnfsf9 T C 17: 57,105,517 (GRCm38) L29P possibly damaging Het
Tnip2 T C 5: 34,496,871 (GRCm38) H391R probably benign Het
Traf5 A G 1: 191,997,807 (GRCm38) Y125H Het
Ttc23 T G 7: 67,667,213 (GRCm38) I77M probably damaging Het
Ube2l3 T C 16: 17,160,172 (GRCm38) N43S probably benign Het
Vars2 A T 17: 35,666,211 (GRCm38) C142* probably null Het
Vmn2r15 A C 5: 109,287,142 (GRCm38) D565E probably damaging Het
Vmn2r56 C T 7: 12,715,226 (GRCm38) probably null Het
Vmn2r85 A T 10: 130,425,703 (GRCm38) M255K probably benign Het
Wfdc6a T A 2: 164,579,826 (GRCm38) *137C probably null Het
Wipi2 T C 5: 142,666,884 (GRCm38) V417A probably benign Het
Xirp2 G T 2: 67,509,772 (GRCm38) V786L possibly damaging Het
Zdhhc13 G A 7: 48,795,949 (GRCm38) G26S probably benign Het
Zscan25 T A 5: 145,290,612 (GRCm38) V362D probably damaging Het
Other mutations in Vmn2r79
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01401:Vmn2r79 APN 7 87,037,273 (GRCm38) missense probably benign 0.01
IGL01675:Vmn2r79 APN 7 86,996,648 (GRCm38) missense probably benign 0.01
IGL01760:Vmn2r79 APN 7 87,002,158 (GRCm38) missense probably benign
IGL01834:Vmn2r79 APN 7 87,037,146 (GRCm38) missense probably benign 0.01
IGL01843:Vmn2r79 APN 7 87,037,277 (GRCm38) missense probably damaging 1.00
IGL01914:Vmn2r79 APN 7 87,037,363 (GRCm38) missense probably benign 0.14
IGL01980:Vmn2r79 APN 7 87,037,082 (GRCm38) missense possibly damaging 0.49
IGL02438:Vmn2r79 APN 7 87,002,536 (GRCm38) missense probably damaging 0.98
IGL02740:Vmn2r79 APN 7 87,004,158 (GRCm38) missense probably benign 0.00
IGL03052:Vmn2r79 UTSW 7 87,003,591 (GRCm38) missense probably benign 0.00
R0096:Vmn2r79 UTSW 7 87,037,319 (GRCm38) missense probably damaging 1.00
R0096:Vmn2r79 UTSW 7 87,037,319 (GRCm38) missense probably damaging 1.00
R0270:Vmn2r79 UTSW 7 87,003,386 (GRCm38) missense probably benign 0.00
R0336:Vmn2r79 UTSW 7 87,002,079 (GRCm38) missense probably benign 0.15
R0418:Vmn2r79 UTSW 7 87,002,403 (GRCm38) missense probably benign 0.18
R1070:Vmn2r79 UTSW 7 87,003,473 (GRCm38) missense probably damaging 1.00
R1234:Vmn2r79 UTSW 7 87,004,099 (GRCm38) missense possibly damaging 0.71
R1459:Vmn2r79 UTSW 7 87,037,794 (GRCm38) missense probably benign 0.01
R1513:Vmn2r79 UTSW 7 87,037,444 (GRCm38) missense probably benign 0.01
R1624:Vmn2r79 UTSW 7 87,004,039 (GRCm38) critical splice acceptor site probably null
R1633:Vmn2r79 UTSW 7 87,037,834 (GRCm38) missense possibly damaging 0.52
R1676:Vmn2r79 UTSW 7 87,002,631 (GRCm38) missense probably benign
R1781:Vmn2r79 UTSW 7 87,002,347 (GRCm38) missense probably benign 0.00
R1794:Vmn2r79 UTSW 7 87,001,413 (GRCm38) missense probably benign 0.37
R1823:Vmn2r79 UTSW 7 87,037,872 (GRCm38) missense probably damaging 1.00
R2013:Vmn2r79 UTSW 7 87,004,081 (GRCm38) missense possibly damaging 0.50
R2018:Vmn2r79 UTSW 7 87,002,426 (GRCm38) missense probably benign 0.07
R2019:Vmn2r79 UTSW 7 87,002,426 (GRCm38) missense probably benign 0.07
R2177:Vmn2r79 UTSW 7 86,996,631 (GRCm38) missense possibly damaging 0.94
R2984:Vmn2r79 UTSW 7 87,001,891 (GRCm38) missense possibly damaging 0.85
R3719:Vmn2r79 UTSW 7 87,002,037 (GRCm38) missense probably benign 0.05
R3798:Vmn2r79 UTSW 7 87,002,194 (GRCm38) missense possibly damaging 0.88
R3969:Vmn2r79 UTSW 7 87,003,593 (GRCm38) missense probably damaging 1.00
R4182:Vmn2r79 UTSW 7 87,001,891 (GRCm38) missense possibly damaging 0.85
R4183:Vmn2r79 UTSW 7 87,001,891 (GRCm38) missense possibly damaging 0.85
R4245:Vmn2r79 UTSW 7 87,002,416 (GRCm38) missense possibly damaging 0.73
R4301:Vmn2r79 UTSW 7 87,001,891 (GRCm38) missense possibly damaging 0.85
R4391:Vmn2r79 UTSW 7 87,001,891 (GRCm38) missense possibly damaging 0.85
R4393:Vmn2r79 UTSW 7 87,001,891 (GRCm38) missense possibly damaging 0.85
R4394:Vmn2r79 UTSW 7 87,001,891 (GRCm38) missense possibly damaging 0.85
R4396:Vmn2r79 UTSW 7 87,001,891 (GRCm38) missense possibly damaging 0.85
R4397:Vmn2r79 UTSW 7 87,001,891 (GRCm38) missense possibly damaging 0.85
R4592:Vmn2r79 UTSW 7 87,004,111 (GRCm38) missense possibly damaging 0.86
R4697:Vmn2r79 UTSW 7 87,037,960 (GRCm38) missense probably damaging 0.98
R4897:Vmn2r79 UTSW 7 87,001,467 (GRCm38) missense probably benign
R5016:Vmn2r79 UTSW 7 87,037,340 (GRCm38) missense probably benign 0.00
R5058:Vmn2r79 UTSW 7 87,002,215 (GRCm38) missense probably damaging 0.98
R5177:Vmn2r79 UTSW 7 87,001,969 (GRCm38) missense probably damaging 0.97
R6078:Vmn2r79 UTSW 7 87,004,111 (GRCm38) missense possibly damaging 0.86
R6079:Vmn2r79 UTSW 7 87,004,111 (GRCm38) missense possibly damaging 0.86
R6138:Vmn2r79 UTSW 7 87,004,111 (GRCm38) missense possibly damaging 0.86
R6257:Vmn2r79 UTSW 7 87,002,570 (GRCm38) missense probably benign 0.27
R6260:Vmn2r79 UTSW 7 87,037,157 (GRCm38) missense probably benign 0.00
R6307:Vmn2r79 UTSW 7 87,037,768 (GRCm38) missense probably damaging 1.00
R6323:Vmn2r79 UTSW 7 87,001,314 (GRCm38) missense probably benign 0.05
R6374:Vmn2r79 UTSW 7 87,002,290 (GRCm38) missense probably benign 0.02
R6530:Vmn2r79 UTSW 7 87,002,044 (GRCm38) missense possibly damaging 0.91
R6546:Vmn2r79 UTSW 7 87,003,533 (GRCm38) missense probably benign 0.01
R6682:Vmn2r79 UTSW 7 87,004,162 (GRCm38) missense possibly damaging 0.69
R6858:Vmn2r79 UTSW 7 87,037,372 (GRCm38) missense probably benign
R6965:Vmn2r79 UTSW 7 87,001,892 (GRCm38) missense probably benign 0.10
R7130:Vmn2r79 UTSW 7 87,002,266 (GRCm38) missense probably damaging 0.99
R7156:Vmn2r79 UTSW 7 87,037,643 (GRCm38) missense probably damaging 0.98
R7604:Vmn2r79 UTSW 7 87,003,384 (GRCm38) critical splice acceptor site probably null
R7691:Vmn2r79 UTSW 7 87,037,903 (GRCm38) missense probably damaging 0.96
R8055:Vmn2r79 UTSW 7 87,037,333 (GRCm38) missense possibly damaging 0.94
R8070:Vmn2r79 UTSW 7 87,002,128 (GRCm38) missense probably benign
R8073:Vmn2r79 UTSW 7 87,002,254 (GRCm38) missense probably benign 0.00
R8145:Vmn2r79 UTSW 7 87,037,654 (GRCm38) missense probably benign 0.02
R8263:Vmn2r79 UTSW 7 87,037,518 (GRCm38) missense possibly damaging 0.89
R8350:Vmn2r79 UTSW 7 87,037,533 (GRCm38) nonsense probably null
R8400:Vmn2r79 UTSW 7 87,002,100 (GRCm38) missense probably benign 0.00
R8814:Vmn2r79 UTSW 7 87,002,506 (GRCm38) missense probably benign 0.00
R8862:Vmn2r79 UTSW 7 86,996,504 (GRCm38) missense probably benign 0.23
R9146:Vmn2r79 UTSW 7 87,001,473 (GRCm38) nonsense probably null
R9276:Vmn2r79 UTSW 7 87,037,837 (GRCm38) missense probably damaging 1.00
R9361:Vmn2r79 UTSW 7 87,003,614 (GRCm38) critical splice donor site probably null
R9676:Vmn2r79 UTSW 7 87,037,244 (GRCm38) missense probably damaging 1.00
U15987:Vmn2r79 UTSW 7 87,004,111 (GRCm38) missense possibly damaging 0.86
X0054:Vmn2r79 UTSW 7 87,004,062 (GRCm38) missense probably benign 0.01
Z1088:Vmn2r79 UTSW 7 87,002,341 (GRCm38) missense probably damaging 1.00
Z1176:Vmn2r79 UTSW 7 87,037,169 (GRCm38) missense probably benign
Z1176:Vmn2r79 UTSW 7 87,002,318 (GRCm38) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGAACTGGGTAGGAGTCATC -3'
(R):5'- ACTGTAGTTAGATGGGTGCAC -3'

Sequencing Primer
(F):5'- CTGGGTAGGAGTCATCATTACAG -3'
(R):5'- CTGTCTGCATGAATTGTTTAAAACC -3'
Posted On 2019-06-07