Incidental Mutation 'PIT4445001:Galr2'
ID 555423
Institutional Source Beutler Lab
Gene Symbol Galr2
Ensembl Gene ENSMUSG00000020793
Gene Name galanin receptor 2
Synonyms mGalR, GalR2
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # PIT4445001 (G1)
Quality Score 131.008
Status Not validated
Chromosome 11
Chromosomal Location 116280939-116283938 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 116281648 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 55 (A55S)
Ref Sequence ENSEMBL: ENSMUSP00000054062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055872]
AlphaFold O88854
Predicted Effect probably benign
Transcript: ENSMUST00000055872
AA Change: A55S

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000054062
Gene: ENSMUSG00000020793
AA Change: A55S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 306 4.1e-12 PFAM
Pfam:7tm_1 41 291 6.4e-52 PFAM
Pfam:7TM_GPCR_Srv 62 307 1.2e-7 PFAM
Pfam:7TM_GPCR_Srw 184 308 4.7e-8 PFAM
low complexity region 347 358 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 90.8%
  • 10x: 84.5%
  • 20x: 70.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Galanin is an important neuromodulator present in the brain, gastrointestinal system, and hypothalamopituitary axis. It is a 30-amino acid non-C-terminally amidated peptide that potently stimulates growth hormone secretion, inhibits cardiac vagal slowing of heart rate, abolishes sinus arrhythmia, and inhibits postprandial gastrointestinal motility. The actions of galanin are mediated through interaction with specific membrane receptors that are members of the 7-transmembrane family of G protein-coupled receptors. GALR2 interacts with the N-terminal residues of the galanin peptide. The primary signaling mechanism for GALR2 is through the phospholipase C/protein kinase C pathway (via Gq), in contrast to GALR1, which communicates its intracellular signal by inhibition of adenylyl cyclase through Gi. However, it has been demonstrated that GALR2 couples efficiently to both the Gq and Gi proteins to simultaneously activate 2 independent signal transduction pathways. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a reduction in exploratory activity. There is also a modest shift in the distribution of different lymphocyte cell types. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,075,551 K419E probably damaging Het
Adam7 T A 14: 68,509,748 K587N possibly damaging Het
Agl T C 3: 116,771,460 M382V Het
Agpat3 A T 10: 78,274,093 F341I possibly damaging Het
Ampd2 A T 3: 108,075,012 L767Q probably damaging Het
Arhgap28 A T 17: 67,896,235 D124E possibly damaging Het
Arhgap32 T C 9: 32,260,856 L1644P probably damaging Het
Asic4 T C 1: 75,451,127 V99A probably benign Het
Asns T A 6: 7,689,277 N75I probably damaging Het
Atp10a A G 7: 58,803,467 D798G probably damaging Het
Atp8a1 A G 5: 67,622,660 V1145A Het
BC017158 A G 7: 128,276,534 V243A probably benign Het
Ccdc171 A G 4: 83,661,747 Q577R probably damaging Het
Cd247 T A 1: 165,861,036 D154E probably damaging Het
Ceacam1 A T 7: 25,476,456 N104K probably damaging Het
Chfr A G 5: 110,151,677 D312G possibly damaging Het
Ddb1 C A 19: 10,625,970 L881I probably damaging Het
Dgkh A T 14: 78,575,942 I1032N possibly damaging Het
Efcab6 A T 15: 83,904,267 V942D probably benign Het
Fmo5 A G 3: 97,651,528 T435A probably benign Het
Fpr1 T C 17: 17,876,893 Q278R probably benign Het
Fzr1 C T 10: 81,369,394 W256* probably null Het
Gabrb1 T C 5: 72,108,782 S261P probably damaging Het
Gbp2 A T 3: 142,637,466 K581N probably benign Het
Gm7682 T G 5: 94,448,507 W468G probably benign Het
Gria1 A T 11: 57,185,838 Y89F probably damaging Het
Ibsp T A 5: 104,302,304 I26N possibly damaging Het
Igf1r T C 7: 68,207,463 F1058L probably damaging Het
Ighv1-16 A C 12: 114,666,060 C36G probably benign Het
Igll1 T C 16: 16,860,919 T176A probably benign Het
Ilkap T C 1: 91,385,345 T143A probably benign Het
Kdm3b A T 18: 34,793,115 K103* probably null Het
Mphosph9 A G 5: 124,298,790 I497T possibly damaging Het
Mrgpra3 G A 7: 47,590,160 T6I possibly damaging Het
Mrpl38 T C 11: 116,132,558 probably null Het
Myo3a A T 2: 22,542,415 E813V possibly damaging Het
Myo7b G T 18: 31,959,466 Q2093K possibly damaging Het
Myo7b T C 18: 31,962,352 K1851R probably damaging Het
P3h2 T A 16: 25,984,999 D339V probably benign Het
Pcdhb6 C A 18: 37,335,247 P407Q possibly damaging Het
Plch2 C A 4: 155,009,026 R153L probably damaging Het
Plppr4 G A 3: 117,360,308 probably benign Het
Ppp1r3a A G 6: 14,717,777 F1046S probably damaging Het
Prkacb A T 3: 146,755,691 L107M probably benign Het
Ranbp17 A G 11: 33,481,020 probably null Het
Rasl11b C A 5: 74,197,333 P88Q probably damaging Het
Rcc2 A G 4: 140,721,149 E503G possibly damaging Het
Rnf216 T A 5: 143,086,003 K407N probably damaging Het
Scrn3 G A 2: 73,318,329 M81I possibly damaging Het
Scube2 T C 7: 109,809,180 T687A probably benign Het
Serpinb10 T A 1: 107,535,998 F3L probably benign Het
Sgcb C T 5: 73,639,812 V202I probably damaging Het
Sgce A G 6: 4,689,654 V429A possibly damaging Het
Sh3rf2 T C 18: 42,153,164 V574A probably benign Het
Sncaip T C 18: 52,868,944 L179S probably damaging Het
Sntg2 A T 12: 30,312,572 D58E probably damaging Het
Taar3 T C 10: 23,949,688 I44T possibly damaging Het
Tmem87b G A 2: 128,831,471 V227I probably benign Het
Tnfsf9 T C 17: 57,105,517 L29P possibly damaging Het
Tnip2 T C 5: 34,496,871 H391R probably benign Het
Traf5 A G 1: 191,997,807 Y125H Het
Ttc23 T G 7: 67,667,213 I77M probably damaging Het
Ube2l3 T C 16: 17,160,172 N43S probably benign Het
Vars2 A T 17: 35,666,211 C142* probably null Het
Vmn2r15 A C 5: 109,287,142 D565E probably damaging Het
Vmn2r56 C T 7: 12,715,226 probably null Het
Vmn2r79 A T 7: 87,002,200 D269V possibly damaging Het
Vmn2r85 A T 10: 130,425,703 M255K probably benign Het
Wfdc6a T A 2: 164,579,826 *137C probably null Het
Wipi2 T C 5: 142,666,884 V417A probably benign Het
Xirp2 G T 2: 67,509,772 V786L possibly damaging Het
Zdhhc13 G A 7: 48,795,949 G26S probably benign Het
Zscan25 T A 5: 145,290,612 V362D probably damaging Het
Other mutations in Galr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Galr2 APN 11 116283170 missense probably damaging 1.00
PIT4418001:Galr2 UTSW 11 116283258 missense probably benign 0.35
R0426:Galr2 UTSW 11 116281691 missense probably damaging 1.00
R1869:Galr2 UTSW 11 116283243 missense possibly damaging 0.87
R2059:Galr2 UTSW 11 116282939 missense probably damaging 1.00
R4579:Galr2 UTSW 11 116281499 missense probably benign
R4666:Galr2 UTSW 11 116283629 missense probably benign
R5832:Galr2 UTSW 11 116281631 missense probably damaging 1.00
R5974:Galr2 UTSW 11 116283026 missense possibly damaging 0.62
R7081:Galr2 UTSW 11 116283048 missense probably damaging 0.99
R7155:Galr2 UTSW 11 116283582 missense possibly damaging 0.94
R7696:Galr2 UTSW 11 116283167 missense probably damaging 1.00
R7810:Galr2 UTSW 11 116283120 missense probably benign 0.23
R8921:Galr2 UTSW 11 116283147 missense probably damaging 1.00
R9231:Galr2 UTSW 11 116283509 missense probably benign
R9514:Galr2 UTSW 11 116283626 missense probably benign
X0009:Galr2 UTSW 11 116283323 missense probably benign 0.14
X0026:Galr2 UTSW 11 116281751 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCGTCTGCTTTGGTGATACC -3'
(R):5'- CAGAATGTTCACTCACCTGTCC -3'

Sequencing Primer
(F):5'- CCATGAATGGCTCGGACAG -3'
(R):5'- TCACCTGTCCAGCGAGACAG -3'
Posted On 2019-06-07