Incidental Mutation 'PIT4445001:Dgkh'
ID555427
Institutional Source Beutler Lab
Gene Symbol Dgkh
Ensembl Gene ENSMUSG00000034731
Gene Namediacylglycerol kinase, eta
Synonyms5930402B05Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4445001 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location78558750-78732776 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 78575942 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 1032 (I1032N)
Ref Sequence ENSEMBL: ENSMUSP00000154554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074729] [ENSMUST00000226342] [ENSMUST00000227537] [ENSMUST00000227767] [ENSMUST00000228362]
Predicted Effect probably benign
Transcript: ENSMUST00000074729
SMART Domains Protein: ENSMUSP00000074290
Gene: ENSMUSG00000034731

DomainStartEndE-ValueType
low complexity region 12 32 N/A INTRINSIC
PH 63 157 1.91e-19 SMART
C1 173 222 1.35e-16 SMART
C1 245 295 1.66e-7 SMART
DAGKc 329 454 3.11e-62 SMART
low complexity region 654 667 N/A INTRINSIC
low complexity region 715 730 N/A INTRINSIC
DAGKa 762 919 1.74e-92 SMART
low complexity region 1124 1134 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226342
Predicted Effect probably benign
Transcript: ENSMUST00000227537
Predicted Effect unknown
Transcript: ENSMUST00000227767
AA Change: H1030Q
Predicted Effect possibly damaging
Transcript: ENSMUST00000228362
AA Change: I1032N

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 90.8%
  • 10x: 84.5%
  • 20x: 70.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the diacylglycerol kinase (DGK) enzyme family. Members of this family are involved in regulating intracellular concentrations of diacylglycerol and phosphatidic acid. Variation in this gene has been associated with bipolar disorder. Alternatively spliced transcript variants have been identified. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,075,551 K419E probably damaging Het
Adam7 T A 14: 68,509,748 K587N possibly damaging Het
Agl T C 3: 116,771,460 M382V Het
Agpat3 A T 10: 78,274,093 F341I possibly damaging Het
Ampd2 A T 3: 108,075,012 L767Q probably damaging Het
Arhgap28 A T 17: 67,896,235 D124E possibly damaging Het
Arhgap32 T C 9: 32,260,856 L1644P probably damaging Het
Asic4 T C 1: 75,451,127 V99A probably benign Het
Asns T A 6: 7,689,277 N75I probably damaging Het
Atp10a A G 7: 58,803,467 D798G probably damaging Het
Atp8a1 A G 5: 67,622,660 V1145A Het
BC017158 A G 7: 128,276,534 V243A probably benign Het
Ccdc171 A G 4: 83,661,747 Q577R probably damaging Het
Cd247 T A 1: 165,861,036 D154E probably damaging Het
Ceacam1 A T 7: 25,476,456 N104K probably damaging Het
Chfr A G 5: 110,151,677 D312G possibly damaging Het
Ddb1 C A 19: 10,625,970 L881I probably damaging Het
Efcab6 A T 15: 83,904,267 V942D probably benign Het
Fmo5 A G 3: 97,651,528 T435A probably benign Het
Fpr1 T C 17: 17,876,893 Q278R probably benign Het
Fzr1 C T 10: 81,369,394 W256* probably null Het
Gabrb1 T C 5: 72,108,782 S261P probably damaging Het
Galr2 G T 11: 116,281,648 A55S probably benign Het
Gbp2 A T 3: 142,637,466 K581N probably benign Het
Gm7682 T G 5: 94,448,507 W468G probably benign Het
Gria1 A T 11: 57,185,838 Y89F probably damaging Het
Ibsp T A 5: 104,302,304 I26N possibly damaging Het
Igf1r T C 7: 68,207,463 F1058L probably damaging Het
Ighv1-16 A C 12: 114,666,060 C36G probably benign Het
Igll1 T C 16: 16,860,919 T176A probably benign Het
Ilkap T C 1: 91,385,345 T143A probably benign Het
Kdm3b A T 18: 34,793,115 K103* probably null Het
Mphosph9 A G 5: 124,298,790 I497T possibly damaging Het
Mrgpra3 G A 7: 47,590,160 T6I possibly damaging Het
Mrpl38 T C 11: 116,132,558 probably null Het
Myo3a A T 2: 22,542,415 E813V possibly damaging Het
Myo7b G T 18: 31,959,466 Q2093K possibly damaging Het
Myo7b T C 18: 31,962,352 K1851R probably damaging Het
P3h2 T A 16: 25,984,999 D339V probably benign Het
Pcdhb6 C A 18: 37,335,247 P407Q possibly damaging Het
Plch2 C A 4: 155,009,026 R153L probably damaging Het
Plppr4 G A 3: 117,360,308 probably benign Het
Ppp1r3a A G 6: 14,717,777 F1046S probably damaging Het
Prkacb A T 3: 146,755,691 L107M probably benign Het
Ranbp17 A G 11: 33,481,020 probably null Het
Rasl11b C A 5: 74,197,333 P88Q probably damaging Het
Rcc2 A G 4: 140,721,149 E503G possibly damaging Het
Rnf216 T A 5: 143,086,003 K407N probably damaging Het
Scrn3 G A 2: 73,318,329 M81I possibly damaging Het
Scube2 T C 7: 109,809,180 T687A probably benign Het
Serpinb10 T A 1: 107,535,998 F3L probably benign Het
Sgcb C T 5: 73,639,812 V202I probably damaging Het
Sgce A G 6: 4,689,654 V429A possibly damaging Het
Sh3rf2 T C 18: 42,153,164 V574A probably benign Het
Sncaip T C 18: 52,868,944 L179S probably damaging Het
Sntg2 A T 12: 30,312,572 D58E probably damaging Het
Taar3 T C 10: 23,949,688 I44T possibly damaging Het
Tmem87b G A 2: 128,831,471 V227I probably benign Het
Tnfsf9 T C 17: 57,105,517 L29P possibly damaging Het
Tnip2 T C 5: 34,496,871 H391R probably benign Het
Traf5 A G 1: 191,997,807 Y125H Het
Ttc23 T G 7: 67,667,213 I77M probably damaging Het
Ube2l3 T C 16: 17,160,172 N43S probably benign Het
Vars2 A T 17: 35,666,211 C142* probably null Het
Vmn2r15 A C 5: 109,287,142 D565E probably damaging Het
Vmn2r56 C T 7: 12,715,226 probably null Het
Vmn2r79 A T 7: 87,002,200 D269V possibly damaging Het
Vmn2r85 A T 10: 130,425,703 M255K probably benign Het
Wfdc6a T A 2: 164,579,826 *137C probably null Het
Wipi2 T C 5: 142,666,884 V417A probably benign Het
Xirp2 G T 2: 67,509,772 V786L possibly damaging Het
Zdhhc13 G A 7: 48,795,949 G26S probably benign Het
Zscan25 T A 5: 145,290,612 V362D probably damaging Het
Other mutations in Dgkh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Dgkh APN 14 78609593 missense possibly damaging 0.92
IGL00767:Dgkh APN 14 78587261 splice site probably benign
IGL00787:Dgkh APN 14 78618514 splice site probably benign
IGL01503:Dgkh APN 14 78616270 missense possibly damaging 0.96
IGL02308:Dgkh APN 14 78587576 missense probably benign 0.01
IGL02707:Dgkh APN 14 78585651 missense possibly damaging 0.75
IGL02987:Dgkh APN 14 78589872 critical splice donor site probably null
IGL03058:Dgkh APN 14 78627797 missense probably benign 0.23
IGL03341:Dgkh APN 14 78595491 splice site probably benign
PIT1430001:Dgkh UTSW 14 78581513 missense probably damaging 1.00
R0153:Dgkh UTSW 14 78570129 nonsense probably null
R0730:Dgkh UTSW 14 78584479 missense probably damaging 0.99
R1136:Dgkh UTSW 14 78624889 missense probably damaging 1.00
R1162:Dgkh UTSW 14 78624451 missense probably damaging 1.00
R1689:Dgkh UTSW 14 78618544 missense possibly damaging 0.86
R1771:Dgkh UTSW 14 78609527 missense probably damaging 1.00
R1861:Dgkh UTSW 14 78578792 missense probably benign 0.04
R1916:Dgkh UTSW 14 78595223 missense probably damaging 0.97
R1930:Dgkh UTSW 14 78616505 missense probably damaging 1.00
R1931:Dgkh UTSW 14 78616505 missense probably damaging 1.00
R1956:Dgkh UTSW 14 78618541 missense probably damaging 1.00
R2007:Dgkh UTSW 14 78603049 missense probably benign 0.09
R3747:Dgkh UTSW 14 78584445 missense probably damaging 1.00
R4446:Dgkh UTSW 14 78628083 missense probably damaging 1.00
R4475:Dgkh UTSW 14 78589878 missense possibly damaging 0.80
R4965:Dgkh UTSW 14 78624421 missense probably damaging 1.00
R4970:Dgkh UTSW 14 78618637 missense probably damaging 1.00
R5071:Dgkh UTSW 14 78604532 missense probably damaging 1.00
R5652:Dgkh UTSW 14 78627761 missense probably damaging 1.00
R5726:Dgkh UTSW 14 78624902 missense probably benign 0.16
R5773:Dgkh UTSW 14 78595455 missense probably damaging 1.00
R5855:Dgkh UTSW 14 78624504 critical splice acceptor site probably null
R6041:Dgkh UTSW 14 78587627 missense probably damaging 1.00
R6192:Dgkh UTSW 14 78628064 nonsense probably null
R6868:Dgkh UTSW 14 78624853 missense probably damaging 0.99
R6981:Dgkh UTSW 14 78627742 nonsense probably null
R7095:Dgkh UTSW 14 78627784 missense probably benign 0.07
R7473:Dgkh UTSW 14 78599043 missense probably benign 0.00
R7495:Dgkh UTSW 14 78578799 missense probably benign
R7711:Dgkh UTSW 14 78725019 missense probably benign
R7727:Dgkh UTSW 14 78595145 critical splice donor site probably null
R7823:Dgkh UTSW 14 78604481 missense probably benign
R7846:Dgkh UTSW 14 78618586 missense probably damaging 0.99
R7929:Dgkh UTSW 14 78618586 missense probably damaging 0.99
X0022:Dgkh UTSW 14 78595461 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATAATGCAAGCCAAGCTGG -3'
(R):5'- TCTGTAACCTGCATGGGGAG -3'

Sequencing Primer
(F):5'- GAAGCACACGACAGAGGACTC -3'
(R):5'- GTCGAAGCATCTTCTGTCACCG -3'
Posted On2019-06-07