Incidental Mutation 'PIT4445001:Arhgap28'
ID555435
Institutional Source Beutler Lab
Gene Symbol Arhgap28
Ensembl Gene ENSMUSG00000024043
Gene NameRho GTPase activating protein 28
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4445001 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location67842713-68004120 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67896235 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 124 (D124E)
Ref Sequence ENSEMBL: ENSMUSP00000024840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024840] [ENSMUST00000163865] [ENSMUST00000164647]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024840
AA Change: D124E

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000024840
Gene: ENSMUSG00000024043
AA Change: D124E

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
RhoGAP 400 578 1.41e-34 SMART
Blast:RhoGAP 583 612 2e-7 BLAST
Blast:RhoGAP 640 681 9e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000163865
AA Change: D74E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130960
Gene: ENSMUSG00000024043
AA Change: D74E

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
RhoGAP 350 527 7.1e-31 SMART
Blast:RhoGAP 532 561 1e-7 BLAST
Blast:RhoGAP 589 630 8e-6 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000164647
AA Change: D74E

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128194
Gene: ENSMUSG00000024043
AA Change: D74E

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
RhoGAP 350 528 1.41e-34 SMART
Blast:RhoGAP 533 562 1e-7 BLAST
Blast:RhoGAP 590 631 8e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000170581
SMART Domains Protein: ENSMUSP00000131903
Gene: ENSMUSG00000024043

DomainStartEndE-ValueType
Blast:RhoGAP 151 213 1e-33 BLAST
SCOP:d1tx4a_ 182 235 1e-10 SMART
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 90.8%
  • 10x: 84.5%
  • 20x: 70.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal bone length and ossification. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,075,551 K419E probably damaging Het
Adam7 T A 14: 68,509,748 K587N possibly damaging Het
Agl T C 3: 116,771,460 M382V Het
Agpat3 A T 10: 78,274,093 F341I possibly damaging Het
Ampd2 A T 3: 108,075,012 L767Q probably damaging Het
Arhgap32 T C 9: 32,260,856 L1644P probably damaging Het
Asic4 T C 1: 75,451,127 V99A probably benign Het
Asns T A 6: 7,689,277 N75I probably damaging Het
Atp10a A G 7: 58,803,467 D798G probably damaging Het
Atp8a1 A G 5: 67,622,660 V1145A Het
BC017158 A G 7: 128,276,534 V243A probably benign Het
Ccdc171 A G 4: 83,661,747 Q577R probably damaging Het
Cd247 T A 1: 165,861,036 D154E probably damaging Het
Ceacam1 A T 7: 25,476,456 N104K probably damaging Het
Chfr A G 5: 110,151,677 D312G possibly damaging Het
Ddb1 C A 19: 10,625,970 L881I probably damaging Het
Dgkh A T 14: 78,575,942 I1032N possibly damaging Het
Efcab6 A T 15: 83,904,267 V942D probably benign Het
Fmo5 A G 3: 97,651,528 T435A probably benign Het
Fpr1 T C 17: 17,876,893 Q278R probably benign Het
Fzr1 C T 10: 81,369,394 W256* probably null Het
Gabrb1 T C 5: 72,108,782 S261P probably damaging Het
Galr2 G T 11: 116,281,648 A55S probably benign Het
Gbp2 A T 3: 142,637,466 K581N probably benign Het
Gm7682 T G 5: 94,448,507 W468G probably benign Het
Gria1 A T 11: 57,185,838 Y89F probably damaging Het
Ibsp T A 5: 104,302,304 I26N possibly damaging Het
Igf1r T C 7: 68,207,463 F1058L probably damaging Het
Ighv1-16 A C 12: 114,666,060 C36G probably benign Het
Igll1 T C 16: 16,860,919 T176A probably benign Het
Ilkap T C 1: 91,385,345 T143A probably benign Het
Kdm3b A T 18: 34,793,115 K103* probably null Het
Mphosph9 A G 5: 124,298,790 I497T possibly damaging Het
Mrgpra3 G A 7: 47,590,160 T6I possibly damaging Het
Mrpl38 T C 11: 116,132,558 probably null Het
Myo3a A T 2: 22,542,415 E813V possibly damaging Het
Myo7b G T 18: 31,959,466 Q2093K possibly damaging Het
Myo7b T C 18: 31,962,352 K1851R probably damaging Het
P3h2 T A 16: 25,984,999 D339V probably benign Het
Pcdhb6 C A 18: 37,335,247 P407Q possibly damaging Het
Plch2 C A 4: 155,009,026 R153L probably damaging Het
Plppr4 G A 3: 117,360,308 probably benign Het
Ppp1r3a A G 6: 14,717,777 F1046S probably damaging Het
Prkacb A T 3: 146,755,691 L107M probably benign Het
Ranbp17 A G 11: 33,481,020 probably null Het
Rasl11b C A 5: 74,197,333 P88Q probably damaging Het
Rcc2 A G 4: 140,721,149 E503G possibly damaging Het
Rnf216 T A 5: 143,086,003 K407N probably damaging Het
Scrn3 G A 2: 73,318,329 M81I possibly damaging Het
Scube2 T C 7: 109,809,180 T687A probably benign Het
Serpinb10 T A 1: 107,535,998 F3L probably benign Het
Sgcb C T 5: 73,639,812 V202I probably damaging Het
Sgce A G 6: 4,689,654 V429A possibly damaging Het
Sh3rf2 T C 18: 42,153,164 V574A probably benign Het
Sncaip T C 18: 52,868,944 L179S probably damaging Het
Sntg2 A T 12: 30,312,572 D58E probably damaging Het
Taar3 T C 10: 23,949,688 I44T possibly damaging Het
Tmem87b G A 2: 128,831,471 V227I probably benign Het
Tnfsf9 T C 17: 57,105,517 L29P possibly damaging Het
Tnip2 T C 5: 34,496,871 H391R probably benign Het
Traf5 A G 1: 191,997,807 Y125H Het
Ttc23 T G 7: 67,667,213 I77M probably damaging Het
Ube2l3 T C 16: 17,160,172 N43S probably benign Het
Vars2 A T 17: 35,666,211 C142* probably null Het
Vmn2r15 A C 5: 109,287,142 D565E probably damaging Het
Vmn2r56 C T 7: 12,715,226 probably null Het
Vmn2r79 A T 7: 87,002,200 D269V possibly damaging Het
Vmn2r85 A T 10: 130,425,703 M255K probably benign Het
Wfdc6a T A 2: 164,579,826 *137C probably null Het
Wipi2 T C 5: 142,666,884 V417A probably benign Het
Xirp2 G T 2: 67,509,772 V786L possibly damaging Het
Zdhhc13 G A 7: 48,795,949 G26S probably benign Het
Zscan25 T A 5: 145,290,612 V362D probably damaging Het
Other mutations in Arhgap28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Arhgap28 APN 17 67845801 missense probably damaging 1.00
IGL01388:Arhgap28 APN 17 67853039 unclassified probably benign
IGL01560:Arhgap28 APN 17 67896071 missense probably damaging 1.00
IGL01578:Arhgap28 APN 17 67858200 missense probably benign 0.00
IGL01650:Arhgap28 APN 17 67873132 missense probably damaging 0.97
IGL02383:Arhgap28 APN 17 67896089 missense probably benign 0.00
IGL02403:Arhgap28 APN 17 67873159 missense possibly damaging 0.87
IGL02652:Arhgap28 APN 17 67884800 missense probably benign 0.00
IGL03102:Arhgap28 APN 17 67896236 missense probably damaging 1.00
IGL03209:Arhgap28 APN 17 67868956 missense probably damaging 1.00
IGL03306:Arhgap28 APN 17 67852935 missense probably damaging 1.00
K3955:Arhgap28 UTSW 17 68004006 missense probably damaging 0.98
R0135:Arhgap28 UTSW 17 67864588 missense probably damaging 1.00
R0309:Arhgap28 UTSW 17 67901429 missense probably benign 0.13
R0385:Arhgap28 UTSW 17 67864606 missense probably damaging 1.00
R0412:Arhgap28 UTSW 17 67896258 missense probably damaging 1.00
R0463:Arhgap28 UTSW 17 67896225 missense probably damaging 1.00
R0626:Arhgap28 UTSW 17 67896113 unclassified probably null
R0691:Arhgap28 UTSW 17 67896164 unclassified probably null
R0811:Arhgap28 UTSW 17 67901299 small deletion probably benign
R1150:Arhgap28 UTSW 17 67857464 missense probably damaging 1.00
R1151:Arhgap28 UTSW 17 67857464 missense probably damaging 1.00
R1152:Arhgap28 UTSW 17 67857464 missense probably damaging 1.00
R1426:Arhgap28 UTSW 17 67857464 missense probably damaging 1.00
R1427:Arhgap28 UTSW 17 67857464 missense probably damaging 1.00
R1632:Arhgap28 UTSW 17 67849074 missense probably damaging 0.99
R1747:Arhgap28 UTSW 17 67901309 missense probably benign 0.02
R1951:Arhgap28 UTSW 17 67901341 missense probably benign 0.00
R2031:Arhgap28 UTSW 17 67896116 missense probably damaging 1.00
R2126:Arhgap28 UTSW 17 67869015 missense possibly damaging 0.90
R2181:Arhgap28 UTSW 17 67896117 missense probably damaging 1.00
R3700:Arhgap28 UTSW 17 67901366 missense probably damaging 1.00
R3800:Arhgap28 UTSW 17 67873036 missense probably damaging 1.00
R3811:Arhgap28 UTSW 17 67896093 missense probably benign
R4213:Arhgap28 UTSW 17 67871993 missense probably benign 0.04
R4347:Arhgap28 UTSW 17 67873142 missense probably benign
R4954:Arhgap28 UTSW 17 67869013 nonsense probably null
R5592:Arhgap28 UTSW 17 67858272 missense probably damaging 0.99
R5610:Arhgap28 UTSW 17 67896240 nonsense probably null
R5758:Arhgap28 UTSW 17 67873159 missense probably benign 0.04
R5774:Arhgap28 UTSW 17 67881492 missense possibly damaging 0.94
R6413:Arhgap28 UTSW 17 67875588 missense probably benign 0.00
R6661:Arhgap28 UTSW 17 67845751 missense probably damaging 1.00
R7255:Arhgap28 UTSW 17 67853004 missense probably damaging 0.99
R7324:Arhgap28 UTSW 17 67895884 intron probably null
R7338:Arhgap28 UTSW 17 67896111 missense probably damaging 1.00
R7549:Arhgap28 UTSW 17 67871966 missense probably damaging 1.00
R7860:Arhgap28 UTSW 17 67901282 nonsense probably null
R7943:Arhgap28 UTSW 17 67901282 nonsense probably null
Z1088:Arhgap28 UTSW 17 67861277 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CTGACTCCGAAGATGTCTCTG -3'
(R):5'- ATCTTAGCTGGCTGCCATGG -3'

Sequencing Primer
(F):5'- GTCTCTGACATCCCTGACGG -3'
(R):5'- GATCATGAGCTTAAGACCTTGTCTC -3'
Posted On2019-06-07