Incidental Mutation 'PIT4445001:Myo7b'
ID555436
Institutional Source Beutler Lab
Gene Symbol Myo7b
Ensembl Gene ENSMUSG00000024388
Gene Namemyosin VIIB
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4445001 (G1)
Quality Score185.009
Status Not validated
Chromosome18
Chromosomal Location31959234-32036961 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 31959466 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 2093 (Q2093K)
Ref Sequence ENSEMBL: ENSMUSP00000118046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025254] [ENSMUST00000134663] [ENSMUST00000223753] [ENSMUST00000224328] [ENSMUST00000224383] [ENSMUST00000225404]
Predicted Effect probably benign
Transcript: ENSMUST00000025254
SMART Domains Protein: ENSMUSP00000025254
Gene: ENSMUSG00000024395

DomainStartEndE-ValueType
LIM 14 67 1.15e-14 SMART
LIM 75 126 2.74e-12 SMART
LIM 139 189 3.87e-12 SMART
LIM 197 248 4.31e-19 SMART
LIM 256 308 2.67e-15 SMART
low complexity region 314 330 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000134663
AA Change: Q2093K

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118046
Gene: ENSMUSG00000024388
AA Change: Q2093K

DomainStartEndE-ValueType
MYSc 59 761 N/A SMART
IQ 762 784 1.07e-1 SMART
IQ 785 807 7.01e-6 SMART
IQ 831 853 4.93e-1 SMART
IQ 854 876 1.63e-1 SMART
MyTH4 989 1189 1.14e-71 SMART
B41 1190 1409 3.66e-16 SMART
SH3 1501 1563 3.25e-7 SMART
MyTH4 1641 1790 7.66e-55 SMART
B41 1792 2009 8.19e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223753
Predicted Effect probably benign
Transcript: ENSMUST00000224328
Predicted Effect probably benign
Transcript: ENSMUST00000224383
Predicted Effect probably benign
Transcript: ENSMUST00000225404
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 90.8%
  • 10x: 84.5%
  • 20x: 70.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in brush border microvilli of epithelial cells in the intestines and kidneys. The encoded protein is involved in linking protocadherins to the actin cytoskeleton and is essential for proper microvilli function. This protein aids in the accumulation of intermicrovillar adhesion components such as harmonin and ANKS4B, and this accumulation is necessary for normal brush border action. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,075,551 K419E probably damaging Het
Adam7 T A 14: 68,509,748 K587N possibly damaging Het
Agl T C 3: 116,771,460 M382V Het
Agpat3 A T 10: 78,274,093 F341I possibly damaging Het
Ampd2 A T 3: 108,075,012 L767Q probably damaging Het
Arhgap28 A T 17: 67,896,235 D124E possibly damaging Het
Arhgap32 T C 9: 32,260,856 L1644P probably damaging Het
Asic4 T C 1: 75,451,127 V99A probably benign Het
Asns T A 6: 7,689,277 N75I probably damaging Het
Atp10a A G 7: 58,803,467 D798G probably damaging Het
Atp8a1 A G 5: 67,622,660 V1145A Het
BC017158 A G 7: 128,276,534 V243A probably benign Het
Ccdc171 A G 4: 83,661,747 Q577R probably damaging Het
Cd247 T A 1: 165,861,036 D154E probably damaging Het
Ceacam1 A T 7: 25,476,456 N104K probably damaging Het
Chfr A G 5: 110,151,677 D312G possibly damaging Het
Ddb1 C A 19: 10,625,970 L881I probably damaging Het
Dgkh A T 14: 78,575,942 I1032N possibly damaging Het
Efcab6 A T 15: 83,904,267 V942D probably benign Het
Fmo5 A G 3: 97,651,528 T435A probably benign Het
Fpr1 T C 17: 17,876,893 Q278R probably benign Het
Fzr1 C T 10: 81,369,394 W256* probably null Het
Gabrb1 T C 5: 72,108,782 S261P probably damaging Het
Galr2 G T 11: 116,281,648 A55S probably benign Het
Gbp2 A T 3: 142,637,466 K581N probably benign Het
Gm7682 T G 5: 94,448,507 W468G probably benign Het
Gria1 A T 11: 57,185,838 Y89F probably damaging Het
Ibsp T A 5: 104,302,304 I26N possibly damaging Het
Igf1r T C 7: 68,207,463 F1058L probably damaging Het
Ighv1-16 A C 12: 114,666,060 C36G probably benign Het
Igll1 T C 16: 16,860,919 T176A probably benign Het
Ilkap T C 1: 91,385,345 T143A probably benign Het
Kdm3b A T 18: 34,793,115 K103* probably null Het
Mphosph9 A G 5: 124,298,790 I497T possibly damaging Het
Mrgpra3 G A 7: 47,590,160 T6I possibly damaging Het
Mrpl38 T C 11: 116,132,558 probably null Het
Myo3a A T 2: 22,542,415 E813V possibly damaging Het
P3h2 T A 16: 25,984,999 D339V probably benign Het
Pcdhb6 C A 18: 37,335,247 P407Q possibly damaging Het
Plch2 C A 4: 155,009,026 R153L probably damaging Het
Plppr4 G A 3: 117,360,308 probably benign Het
Ppp1r3a A G 6: 14,717,777 F1046S probably damaging Het
Prkacb A T 3: 146,755,691 L107M probably benign Het
Ranbp17 A G 11: 33,481,020 probably null Het
Rasl11b C A 5: 74,197,333 P88Q probably damaging Het
Rcc2 A G 4: 140,721,149 E503G possibly damaging Het
Rnf216 T A 5: 143,086,003 K407N probably damaging Het
Scrn3 G A 2: 73,318,329 M81I possibly damaging Het
Scube2 T C 7: 109,809,180 T687A probably benign Het
Serpinb10 T A 1: 107,535,998 F3L probably benign Het
Sgcb C T 5: 73,639,812 V202I probably damaging Het
Sgce A G 6: 4,689,654 V429A possibly damaging Het
Sh3rf2 T C 18: 42,153,164 V574A probably benign Het
Sncaip T C 18: 52,868,944 L179S probably damaging Het
Sntg2 A T 12: 30,312,572 D58E probably damaging Het
Taar3 T C 10: 23,949,688 I44T possibly damaging Het
Tmem87b G A 2: 128,831,471 V227I probably benign Het
Tnfsf9 T C 17: 57,105,517 L29P possibly damaging Het
Tnip2 T C 5: 34,496,871 H391R probably benign Het
Traf5 A G 1: 191,997,807 Y125H Het
Ttc23 T G 7: 67,667,213 I77M probably damaging Het
Ube2l3 T C 16: 17,160,172 N43S probably benign Het
Vars2 A T 17: 35,666,211 C142* probably null Het
Vmn2r15 A C 5: 109,287,142 D565E probably damaging Het
Vmn2r56 C T 7: 12,715,226 probably null Het
Vmn2r79 A T 7: 87,002,200 D269V possibly damaging Het
Vmn2r85 A T 10: 130,425,703 M255K probably benign Het
Wfdc6a T A 2: 164,579,826 *137C probably null Het
Wipi2 T C 5: 142,666,884 V417A probably benign Het
Xirp2 G T 2: 67,509,772 V786L possibly damaging Het
Zdhhc13 G A 7: 48,795,949 G26S probably benign Het
Zscan25 T A 5: 145,290,612 V362D probably damaging Het
Other mutations in Myo7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Myo7b APN 18 32021556 utr 5 prime probably benign
IGL01799:Myo7b APN 18 31962770 missense probably damaging 1.00
IGL01881:Myo7b APN 18 32000267 splice site probably benign
IGL01883:Myo7b APN 18 31998151 missense probably damaging 1.00
IGL01934:Myo7b APN 18 32001341 critical splice donor site probably null
IGL01980:Myo7b APN 18 31961900 missense possibly damaging 0.86
IGL02506:Myo7b APN 18 31967154 missense probably damaging 1.00
IGL02704:Myo7b APN 18 31966961 missense probably benign 0.13
IGL02929:Myo7b APN 18 31994925 missense probably benign 0.19
IGL03149:Myo7b APN 18 32014302 missense probably damaging 1.00
IGL03335:Myo7b APN 18 31985020 missense possibly damaging 0.81
IGL03372:Myo7b APN 18 31998601 missense probably damaging 1.00
IGL03385:Myo7b APN 18 31989577 missense probably benign 0.00
PIT4131001:Myo7b UTSW 18 31961206 missense probably benign 0.17
PIT4445001:Myo7b UTSW 18 31962352 missense probably damaging 0.96
R0034:Myo7b UTSW 18 31960860 missense probably damaging 1.00
R0138:Myo7b UTSW 18 32010151 missense probably damaging 1.00
R0149:Myo7b UTSW 18 32014209 missense probably damaging 1.00
R0226:Myo7b UTSW 18 31972896 missense probably benign 0.00
R0312:Myo7b UTSW 18 32014337 missense possibly damaging 0.68
R0361:Myo7b UTSW 18 32014209 missense probably damaging 1.00
R0506:Myo7b UTSW 18 31964386 critical splice donor site probably null
R0524:Myo7b UTSW 18 32013424 missense possibly damaging 0.91
R0645:Myo7b UTSW 18 31994909 missense probably benign 0.10
R0724:Myo7b UTSW 18 32005549 splice site probably benign
R0731:Myo7b UTSW 18 31961825 unclassified probably null
R0762:Myo7b UTSW 18 31983944 missense probably benign 0.01
R0843:Myo7b UTSW 18 31974084 missense possibly damaging 0.83
R0894:Myo7b UTSW 18 32000070 missense probably damaging 1.00
R0966:Myo7b UTSW 18 31998763 missense probably damaging 1.00
R1205:Myo7b UTSW 18 31994342 missense probably damaging 1.00
R1387:Myo7b UTSW 18 31983752 splice site probably benign
R1523:Myo7b UTSW 18 31966876 missense probably damaging 1.00
R1544:Myo7b UTSW 18 31994909 missense probably benign 0.10
R1623:Myo7b UTSW 18 32000051 missense probably damaging 1.00
R1780:Myo7b UTSW 18 31961185 missense probably damaging 1.00
R1785:Myo7b UTSW 18 31994897 missense probably benign
R1786:Myo7b UTSW 18 31994897 missense probably benign
R1796:Myo7b UTSW 18 31986675 missense possibly damaging 0.93
R1907:Myo7b UTSW 18 31976999 missense possibly damaging 0.89
R2027:Myo7b UTSW 18 31984960 missense probably benign
R2102:Myo7b UTSW 18 31999978 missense probably damaging 1.00
R2174:Myo7b UTSW 18 31983557 missense probably damaging 1.00
R2272:Myo7b UTSW 18 31977043 missense probably benign 0.41
R2323:Myo7b UTSW 18 31971345 missense probably damaging 1.00
R2365:Myo7b UTSW 18 32014331 missense probably damaging 0.98
R3078:Myo7b UTSW 18 31967184 missense probably benign 0.04
R3522:Myo7b UTSW 18 32010079 missense probably damaging 1.00
R3788:Myo7b UTSW 18 31974112 missense possibly damaging 0.95
R3880:Myo7b UTSW 18 31969514 missense probably damaging 0.96
R4334:Myo7b UTSW 18 31976987 missense probably damaging 1.00
R4343:Myo7b UTSW 18 31983627 missense probably damaging 1.00
R4497:Myo7b UTSW 18 32014229 missense probably benign 0.06
R4498:Myo7b UTSW 18 32014229 missense probably benign 0.06
R4551:Myo7b UTSW 18 31985108 missense probably benign 0.01
R4593:Myo7b UTSW 18 32013375 missense possibly damaging 0.77
R4616:Myo7b UTSW 18 32003487 splice site probably null
R4646:Myo7b UTSW 18 31994369 missense probably benign 0.25
R4648:Myo7b UTSW 18 31967125 splice site probably null
R4737:Myo7b UTSW 18 31998602 missense probably damaging 1.00
R4765:Myo7b UTSW 18 31961900 missense probably benign 0.00
R4790:Myo7b UTSW 18 32000105 splice site probably null
R4909:Myo7b UTSW 18 31964436 missense probably benign 0.01
R5027:Myo7b UTSW 18 31975212 missense probably benign 0.22
R5034:Myo7b UTSW 18 31971387 missense probably damaging 1.00
R5112:Myo7b UTSW 18 31983587 missense probably damaging 1.00
R5266:Myo7b UTSW 18 31998734 missense probably damaging 1.00
R5267:Myo7b UTSW 18 31998734 missense probably damaging 1.00
R5348:Myo7b UTSW 18 31983919 missense probably damaging 0.96
R5457:Myo7b UTSW 18 31971450 splice site probably null
R5540:Myo7b UTSW 18 32007090 missense probably damaging 1.00
R5628:Myo7b UTSW 18 31974187 missense probably benign
R5815:Myo7b UTSW 18 31966288 missense probably damaging 1.00
R6062:Myo7b UTSW 18 31967990 missense possibly damaging 0.94
R6137:Myo7b UTSW 18 31999974 missense probably damaging 1.00
R6158:Myo7b UTSW 18 31988549 missense probably benign 0.00
R6218:Myo7b UTSW 18 31959454 missense probably benign 0.10
R6256:Myo7b UTSW 18 31983695 missense probably damaging 1.00
R6257:Myo7b UTSW 18 32013415 missense probably damaging 1.00
R6265:Myo7b UTSW 18 31998150 missense probably damaging 1.00
R6302:Myo7b UTSW 18 31994386 missense probably damaging 0.98
R6438:Myo7b UTSW 18 31966329 missense probably damaging 1.00
R6654:Myo7b UTSW 18 31990269 missense possibly damaging 0.46
R7030:Myo7b UTSW 18 31971573 missense probably damaging 1.00
R7090:Myo7b UTSW 18 31998712 missense probably damaging 1.00
R7210:Myo7b UTSW 18 32007102 missense probably damaging 1.00
R7218:Myo7b UTSW 18 31981001 missense probably benign 0.05
R7378:Myo7b UTSW 18 31966239 missense probably damaging 1.00
R7458:Myo7b UTSW 18 31988551 missense possibly damaging 0.89
R7517:Myo7b UTSW 18 32013267 missense probably damaging 0.99
R7559:Myo7b UTSW 18 31983360 missense probably benign 0.01
R7667:Myo7b UTSW 18 31961905 missense probably benign
R7737:Myo7b UTSW 18 32014204 nonsense probably null
R8030:Myo7b UTSW 18 31998082 missense probably damaging 0.96
X0027:Myo7b UTSW 18 31965636 missense probably damaging 1.00
Z1176:Myo7b UTSW 18 31980998 missense possibly damaging 0.82
Z1177:Myo7b UTSW 18 31985056 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCAGATTCAGGGGAGTTACC -3'
(R):5'- CATCCTAGGCCATTCTGAGG -3'

Sequencing Primer
(F):5'- GGAGTTACCCACCATCTGTG -3'
(R):5'- TCCTAGGCCATTCTGAGGAGAGG -3'
Posted On2019-06-07