Incidental Mutation 'PIT4445001:Sh3rf2'
ID555440
Institutional Source Beutler Lab
Gene Symbol Sh3rf2
Ensembl Gene ENSMUSG00000057719
Gene NameSH3 domain containing ring finger 2
Synonyms9130023G24Rik, RNF158
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4445001 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location42053667-42158960 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42153164 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 574 (V574A)
Ref Sequence ENSEMBL: ENSMUSP00000071896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072008] [ENSMUST00000074679]
PDB Structure Solution structure of the SH3 domain of the mouse hypothetical protein SH3RF2 [SOLUTION NMR]
The solution structure of the first SH3 domain of mouse SH3 domain containing ring finger 2 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000072008
AA Change: V574A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000071896
Gene: ENSMUSG00000057719
AA Change: V574A

DomainStartEndE-ValueType
RING 12 52 7.38e-8 SMART
low complexity region 63 73 N/A INTRINSIC
SH3 128 183 4.66e-17 SMART
SH3 190 251 1.45e-13 SMART
low complexity region 357 366 N/A INTRINSIC
SH3 385 442 3.27e-12 SMART
low complexity region 500 514 N/A INTRINSIC
low complexity region 614 631 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074679
AA Change: V542A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000074247
Gene: ENSMUSG00000057719
AA Change: V542A

DomainStartEndE-ValueType
RING 12 52 7.38e-8 SMART
low complexity region 63 73 N/A INTRINSIC
SH3 128 183 4.66e-17 SMART
low complexity region 325 334 N/A INTRINSIC
SH3 353 410 3.27e-12 SMART
low complexity region 468 482 N/A INTRINSIC
low complexity region 582 599 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 90.8%
  • 10x: 84.5%
  • 20x: 70.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,075,551 K419E probably damaging Het
Adam7 T A 14: 68,509,748 K587N possibly damaging Het
Agl T C 3: 116,771,460 M382V Het
Agpat3 A T 10: 78,274,093 F341I possibly damaging Het
Ampd2 A T 3: 108,075,012 L767Q probably damaging Het
Arhgap28 A T 17: 67,896,235 D124E possibly damaging Het
Arhgap32 T C 9: 32,260,856 L1644P probably damaging Het
Asic4 T C 1: 75,451,127 V99A probably benign Het
Asns T A 6: 7,689,277 N75I probably damaging Het
Atp10a A G 7: 58,803,467 D798G probably damaging Het
Atp8a1 A G 5: 67,622,660 V1145A Het
BC017158 A G 7: 128,276,534 V243A probably benign Het
Ccdc171 A G 4: 83,661,747 Q577R probably damaging Het
Cd247 T A 1: 165,861,036 D154E probably damaging Het
Ceacam1 A T 7: 25,476,456 N104K probably damaging Het
Chfr A G 5: 110,151,677 D312G possibly damaging Het
Ddb1 C A 19: 10,625,970 L881I probably damaging Het
Dgkh A T 14: 78,575,942 I1032N possibly damaging Het
Efcab6 A T 15: 83,904,267 V942D probably benign Het
Fmo5 A G 3: 97,651,528 T435A probably benign Het
Fpr1 T C 17: 17,876,893 Q278R probably benign Het
Fzr1 C T 10: 81,369,394 W256* probably null Het
Gabrb1 T C 5: 72,108,782 S261P probably damaging Het
Galr2 G T 11: 116,281,648 A55S probably benign Het
Gbp2 A T 3: 142,637,466 K581N probably benign Het
Gm7682 T G 5: 94,448,507 W468G probably benign Het
Gria1 A T 11: 57,185,838 Y89F probably damaging Het
Ibsp T A 5: 104,302,304 I26N possibly damaging Het
Igf1r T C 7: 68,207,463 F1058L probably damaging Het
Ighv1-16 A C 12: 114,666,060 C36G probably benign Het
Igll1 T C 16: 16,860,919 T176A probably benign Het
Ilkap T C 1: 91,385,345 T143A probably benign Het
Kdm3b A T 18: 34,793,115 K103* probably null Het
Mphosph9 A G 5: 124,298,790 I497T possibly damaging Het
Mrgpra3 G A 7: 47,590,160 T6I possibly damaging Het
Mrpl38 T C 11: 116,132,558 probably null Het
Myo3a A T 2: 22,542,415 E813V possibly damaging Het
Myo7b G T 18: 31,959,466 Q2093K possibly damaging Het
Myo7b T C 18: 31,962,352 K1851R probably damaging Het
P3h2 T A 16: 25,984,999 D339V probably benign Het
Pcdhb6 C A 18: 37,335,247 P407Q possibly damaging Het
Plch2 C A 4: 155,009,026 R153L probably damaging Het
Plppr4 G A 3: 117,360,308 probably benign Het
Ppp1r3a A G 6: 14,717,777 F1046S probably damaging Het
Prkacb A T 3: 146,755,691 L107M probably benign Het
Ranbp17 A G 11: 33,481,020 probably null Het
Rasl11b C A 5: 74,197,333 P88Q probably damaging Het
Rcc2 A G 4: 140,721,149 E503G possibly damaging Het
Rnf216 T A 5: 143,086,003 K407N probably damaging Het
Scrn3 G A 2: 73,318,329 M81I possibly damaging Het
Scube2 T C 7: 109,809,180 T687A probably benign Het
Serpinb10 T A 1: 107,535,998 F3L probably benign Het
Sgcb C T 5: 73,639,812 V202I probably damaging Het
Sgce A G 6: 4,689,654 V429A possibly damaging Het
Sncaip T C 18: 52,868,944 L179S probably damaging Het
Sntg2 A T 12: 30,312,572 D58E probably damaging Het
Taar3 T C 10: 23,949,688 I44T possibly damaging Het
Tmem87b G A 2: 128,831,471 V227I probably benign Het
Tnfsf9 T C 17: 57,105,517 L29P possibly damaging Het
Tnip2 T C 5: 34,496,871 H391R probably benign Het
Traf5 A G 1: 191,997,807 Y125H Het
Ttc23 T G 7: 67,667,213 I77M probably damaging Het
Ube2l3 T C 16: 17,160,172 N43S probably benign Het
Vars2 A T 17: 35,666,211 C142* probably null Het
Vmn2r15 A C 5: 109,287,142 D565E probably damaging Het
Vmn2r56 C T 7: 12,715,226 probably null Het
Vmn2r79 A T 7: 87,002,200 D269V possibly damaging Het
Vmn2r85 A T 10: 130,425,703 M255K probably benign Het
Wfdc6a T A 2: 164,579,826 *137C probably null Het
Wipi2 T C 5: 142,666,884 V417A probably benign Het
Xirp2 G T 2: 67,509,772 V786L possibly damaging Het
Zdhhc13 G A 7: 48,795,949 G26S probably benign Het
Zscan25 T A 5: 145,290,612 V362D probably damaging Het
Other mutations in Sh3rf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Sh3rf2 APN 18 42111218 missense probably benign 0.00
IGL01012:Sh3rf2 APN 18 42054192 missense possibly damaging 0.50
IGL01286:Sh3rf2 APN 18 42139611 critical splice donor site probably null
IGL02369:Sh3rf2 APN 18 42156157 nonsense probably null
IGL02563:Sh3rf2 APN 18 42156142 missense probably damaging 0.99
BB004:Sh3rf2 UTSW 18 42111422 missense probably benign
BB014:Sh3rf2 UTSW 18 42111422 missense probably benign
R0141:Sh3rf2 UTSW 18 42156057 missense probably benign 0.02
R0270:Sh3rf2 UTSW 18 42104081 missense probably damaging 0.99
R1447:Sh3rf2 UTSW 18 42101671 missense probably benign 0.00
R1491:Sh3rf2 UTSW 18 42053939 missense probably damaging 0.99
R1539:Sh3rf2 UTSW 18 42149822 missense probably damaging 1.00
R1595:Sh3rf2 UTSW 18 42111288 missense probably damaging 1.00
R1749:Sh3rf2 UTSW 18 42153294 missense probably damaging 1.00
R1864:Sh3rf2 UTSW 18 42053981 missense probably damaging 0.99
R1942:Sh3rf2 UTSW 18 42149624 missense probably damaging 1.00
R1998:Sh3rf2 UTSW 18 42141083 missense probably damaging 0.99
R2331:Sh3rf2 UTSW 18 42053863 missense probably benign 0.04
R2680:Sh3rf2 UTSW 18 42101650 missense probably damaging 0.98
R2938:Sh3rf2 UTSW 18 42149724 missense probably benign 0.09
R2940:Sh3rf2 UTSW 18 42111440 critical splice donor site probably null
R3753:Sh3rf2 UTSW 18 42111308 missense probably damaging 1.00
R3861:Sh3rf2 UTSW 18 42153319 missense probably damaging 1.00
R4322:Sh3rf2 UTSW 18 42111399 missense probably damaging 1.00
R5076:Sh3rf2 UTSW 18 42053924 missense probably damaging 1.00
R5169:Sh3rf2 UTSW 18 42153061 missense probably benign 0.00
R5228:Sh3rf2 UTSW 18 42153181 missense possibly damaging 0.69
R5437:Sh3rf2 UTSW 18 42141014 missense probably benign 0.44
R5792:Sh3rf2 UTSW 18 42111138 missense probably damaging 0.99
R5820:Sh3rf2 UTSW 18 42141047 missense possibly damaging 0.94
R6159:Sh3rf2 UTSW 18 42156135 missense probably damaging 0.96
R6366:Sh3rf2 UTSW 18 42153065 missense probably benign 0.00
R6640:Sh3rf2 UTSW 18 42101640 missense probably damaging 1.00
R6897:Sh3rf2 UTSW 18 42101605 missense possibly damaging 0.91
R6995:Sh3rf2 UTSW 18 42101541 missense probably damaging 1.00
R7097:Sh3rf2 UTSW 18 42104162 splice site probably null
R7122:Sh3rf2 UTSW 18 42104162 splice site probably null
R7432:Sh3rf2 UTSW 18 42054026 missense probably damaging 0.99
R7444:Sh3rf2 UTSW 18 42101539 missense probably damaging 1.00
R7654:Sh3rf2 UTSW 18 42104108 missense probably damaging 1.00
R7703:Sh3rf2 UTSW 18 42156136 missense probably benign 0.04
R7732:Sh3rf2 UTSW 18 42101688 missense probably damaging 1.00
R7835:Sh3rf2 UTSW 18 42111170 missense probably benign 0.25
R7927:Sh3rf2 UTSW 18 42111422 missense probably benign
R8053:Sh3rf2 UTSW 18 42153022 missense probably damaging 1.00
R8144:Sh3rf2 UTSW 18 42141059 missense probably benign 0.01
R8343:Sh3rf2 UTSW 18 42111428 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGACACATTGCAACCTACATGC -3'
(R):5'- CTGGTTTCACGAGGATGGAG -3'

Sequencing Primer
(F):5'- AATGATGTCATCTACCCTATTGCTG -3'
(R):5'- TTCACGAGGATGGAGGGTGG -3'
Posted On2019-06-07