Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4445001:Ddb1'

555442

Institutional Source

Beutler Lab

Gene Symbol

Ddb1

Ensembl Gene

ENSMUSG00000024740

Gene Name

damage specific DNA binding protein 1

Synonyms

DNA repair protein, p127-Ddb1, damage-specific DNA-binding protein, DNA repair

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

PIT4445001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

10605625-10629813 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 10625970 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Isoleucine at position 881 (L881I)

Ref Sequence

ENSEMBL: ENSMUSP00000025649 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025649]

AlphaFold

Q3U1J4

Predicted Effect

probably damaging
Transcript: ENSMUST00000025649
AA Change: L881I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000025649
Gene: ENSMUSG00000024740
AA Change: L881I

Domain	Start	End	E-Value	Type
Pfam:MMS1_N	75	543	1.9e-122	PFAM
low complexity region	755	775	N/A	INTRINSIC
Pfam:CPSF_A	788	1099	1e-92	PFAM

Coding Region Coverage

1x: 93.5%
3x: 90.8%
10x: 84.5%
20x: 70.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the large subunit (p127) of the heterodimeric DNA damage-binding (DDB) complex while another protein (p48) forms the small subunit. This protein complex functions in nucleotide-excision repair and binds to DNA following UV damage. Defective activity of this complex causes the repair defect in patients with xeroderma pigmentosum complementation group E (XPE) - an autosomal recessive disorder characterized by photosensitivity and early onset of carcinomas. However, it remains for mutation analysis to demonstrate whether the defect in XPE patients is in this gene or the gene encoding the small subunit. In addition, Best vitelliform mascular dystrophy is mapped to the same region as this gene on 11q, but no sequence alternations of this gene are demonstrated in Best disease patients. The protein encoded by this gene also functions as an adaptor molecule for the cullin 4 (CUL4) ubiquitin E3 ligase complex by facilitating the binding of substrates to this complex and the ubiquitination of proteins. [provided by RefSeq, May 2012]
PHENOTYPE: Complete deletion of this gene results in embryonic lethality; conditional mutation causes increased apoptosis in the developing brain, and defects in lens formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8a	T	C	11: 110,075,551	K419E	probably damaging	Het
Adam7	T	A	14: 68,509,748	K587N	possibly damaging	Het
Agl	T	C	3: 116,771,460	M382V		Het
Agpat3	A	T	10: 78,274,093	F341I	possibly damaging	Het
Ampd2	A	T	3: 108,075,012	L767Q	probably damaging	Het
Arhgap28	A	T	17: 67,896,235	D124E	possibly damaging	Het
Arhgap32	T	C	9: 32,260,856	L1644P	probably damaging	Het
Asic4	T	C	1: 75,451,127	V99A	probably benign	Het
Asns	T	A	6: 7,689,277	N75I	probably damaging	Het
Atp10a	A	G	7: 58,803,467	D798G	probably damaging	Het
Atp8a1	A	G	5: 67,622,660	V1145A		Het
BC017158	A	G	7: 128,276,534	V243A	probably benign	Het
Ccdc171	A	G	4: 83,661,747	Q577R	probably damaging	Het
Cd247	T	A	1: 165,861,036	D154E	probably damaging	Het
Ceacam1	A	T	7: 25,476,456	N104K	probably damaging	Het
Chfr	A	G	5: 110,151,677	D312G	possibly damaging	Het
Dgkh	A	T	14: 78,575,942	I1032N	possibly damaging	Het
Efcab6	A	T	15: 83,904,267	V942D	probably benign	Het
Fmo5	A	G	3: 97,651,528	T435A	probably benign	Het
Fpr1	T	C	17: 17,876,893	Q278R	probably benign	Het
Fzr1	C	T	10: 81,369,394	W256*	probably null	Het
Gabrb1	T	C	5: 72,108,782	S261P	probably damaging	Het
Galr2	G	T	11: 116,281,648	A55S	probably benign	Het
Gbp2	A	T	3: 142,637,466	K581N	probably benign	Het
Gm7682	T	G	5: 94,448,507	W468G	probably benign	Het
Gria1	A	T	11: 57,185,838	Y89F	probably damaging	Het
Ibsp	T	A	5: 104,302,304	I26N	possibly damaging	Het
Igf1r	T	C	7: 68,207,463	F1058L	probably damaging	Het
Ighv1-16	A	C	12: 114,666,060	C36G	probably benign	Het
Igll1	T	C	16: 16,860,919	T176A	probably benign	Het
Ilkap	T	C	1: 91,385,345	T143A	probably benign	Het
Kdm3b	A	T	18: 34,793,115	K103*	probably null	Het
Mphosph9	A	G	5: 124,298,790	I497T	possibly damaging	Het
Mrgpra3	G	A	7: 47,590,160	T6I	possibly damaging	Het
Mrpl38	T	C	11: 116,132,558		probably null	Het
Myo3a	A	T	2: 22,542,415	E813V	possibly damaging	Het
Myo7b	G	T	18: 31,959,466	Q2093K	possibly damaging	Het
Myo7b	T	C	18: 31,962,352	K1851R	probably damaging	Het
P3h2	T	A	16: 25,984,999	D339V	probably benign	Het
Pcdhb6	C	A	18: 37,335,247	P407Q	possibly damaging	Het
Plch2	C	A	4: 155,009,026	R153L	probably damaging	Het
Plppr4	G	A	3: 117,360,308		probably benign	Het
Ppp1r3a	A	G	6: 14,717,777	F1046S	probably damaging	Het
Prkacb	A	T	3: 146,755,691	L107M	probably benign	Het
Ranbp17	A	G	11: 33,481,020		probably null	Het
Rasl11b	C	A	5: 74,197,333	P88Q	probably damaging	Het
Rcc2	A	G	4: 140,721,149	E503G	possibly damaging	Het
Rnf216	T	A	5: 143,086,003	K407N	probably damaging	Het
Scrn3	G	A	2: 73,318,329	M81I	possibly damaging	Het
Scube2	T	C	7: 109,809,180	T687A	probably benign	Het
Serpinb10	T	A	1: 107,535,998	F3L	probably benign	Het
Sgcb	C	T	5: 73,639,812	V202I	probably damaging	Het
Sgce	A	G	6: 4,689,654	V429A	possibly damaging	Het
Sh3rf2	T	C	18: 42,153,164	V574A	probably benign	Het
Sncaip	T	C	18: 52,868,944	L179S	probably damaging	Het
Sntg2	A	T	12: 30,312,572	D58E	probably damaging	Het
Taar3	T	C	10: 23,949,688	I44T	possibly damaging	Het
Tmem87b	G	A	2: 128,831,471	V227I	probably benign	Het
Tnfsf9	T	C	17: 57,105,517	L29P	possibly damaging	Het
Tnip2	T	C	5: 34,496,871	H391R	probably benign	Het
Traf5	A	G	1: 191,997,807	Y125H		Het
Ttc23	T	G	7: 67,667,213	I77M	probably damaging	Het
Ube2l3	T	C	16: 17,160,172	N43S	probably benign	Het
Vars2	A	T	17: 35,666,211	C142*	probably null	Het
Vmn2r15	A	C	5: 109,287,142	D565E	probably damaging	Het
Vmn2r56	C	T	7: 12,715,226		probably null	Het
Vmn2r79	A	T	7: 87,002,200	D269V	possibly damaging	Het
Vmn2r85	A	T	10: 130,425,703	M255K	probably benign	Het
Wfdc6a	T	A	2: 164,579,826	*137C	probably null	Het
Wipi2	T	C	5: 142,666,884	V417A	probably benign	Het
Xirp2	G	T	2: 67,509,772	V786L	possibly damaging	Het
Zdhhc13	G	A	7: 48,795,949	G26S	probably benign	Het
Zscan25	T	A	5: 145,290,612	V362D	probably damaging	Het

Other mutations in Ddb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00470:Ddb1	APN	19	10611664	missense	possibly damaging	0.85
IGL00742:Ddb1	APN	19	10610760	missense	probably benign
IGL01161:Ddb1	APN	19	10605707	start codon destroyed	probably null	1.00
IGL01364:Ddb1	APN	19	10627660	critical splice donor site	probably null
IGL01804:Ddb1	APN	19	10613018	missense	probably damaging	1.00
IGL01812:Ddb1	APN	19	10613018	missense	probably damaging	1.00
IGL02523:Ddb1	APN	19	10627632	missense	probably damaging	1.00
IGL02609:Ddb1	APN	19	10622466	missense	possibly damaging	0.93
IGL02664:Ddb1	APN	19	10607883	missense	probably benign
IGL03033:Ddb1	APN	19	10625926	missense	possibly damaging	0.59
IGL03092:Ddb1	APN	19	10612945	missense	probably damaging	1.00
IGL03110:Ddb1	APN	19	10612945	missense	probably damaging	1.00
IGL03256:Ddb1	APN	19	10621861	missense	probably benign	0.01
Dubitable	UTSW	19	10622499	critical splice donor site	probably null
Indubitable	UTSW	19	10607911	critical splice donor site	probably null
Van_der_waals	UTSW	19	10612916	missense	probably benign	0.11
R0028:Ddb1	UTSW	19	10619246	missense	probably damaging	1.00
R0589:Ddb1	UTSW	19	10621716	missense	probably benign	0.02
R0893:Ddb1	UTSW	19	10612916	missense	probably benign	0.11
R1374:Ddb1	UTSW	19	10608318	missense	probably damaging	1.00
R1611:Ddb1	UTSW	19	10612888	missense	probably damaging	1.00
R1611:Ddb1	UTSW	19	10626764	critical splice donor site	probably null
R1661:Ddb1	UTSW	19	10629080	missense	probably benign	0.00
R1835:Ddb1	UTSW	19	10626593	missense	probably damaging	1.00
R2036:Ddb1	UTSW	19	10610822	splice site	probably benign
R2094:Ddb1	UTSW	19	10612936	missense	probably benign
R2142:Ddb1	UTSW	19	10619126	critical splice donor site	probably null
R2213:Ddb1	UTSW	19	10608327	missense	probably damaging	1.00
R2318:Ddb1	UTSW	19	10626628	missense	probably damaging	1.00
R2354:Ddb1	UTSW	19	10606973	missense	probably benign	0.03
R3150:Ddb1	UTSW	19	10612982	missense	probably benign	0.02
R3162:Ddb1	UTSW	19	10625971	missense	probably damaging	0.99
R3162:Ddb1	UTSW	19	10625971	missense	probably damaging	0.99
R3606:Ddb1	UTSW	19	10628493	missense	probably damaging	1.00
R4050:Ddb1	UTSW	19	10627807	missense	probably benign	0.00
R5157:Ddb1	UTSW	19	10622364	missense	probably benign	0.01
R6244:Ddb1	UTSW	19	10625923	missense	probably damaging	0.99
R6249:Ddb1	UTSW	19	10605720	nonsense	probably null
R6812:Ddb1	UTSW	19	10622499	critical splice donor site	probably null
R7337:Ddb1	UTSW	19	10627831	missense	possibly damaging	0.88
R7460:Ddb1	UTSW	19	10607911	critical splice donor site	probably null
R7737:Ddb1	UTSW	19	10625974	missense	possibly damaging	0.93
R7903:Ddb1	UTSW	19	10608348	missense	probably benign	0.12
R8288:Ddb1	UTSW	19	10608348	missense	probably benign	0.12
R8376:Ddb1	UTSW	19	10619305	missense	probably damaging	1.00
R8970:Ddb1	UTSW	19	10608444	missense	probably benign	0.01
R9720:Ddb1	UTSW	19	10608360	missense	probably benign
RF016:Ddb1	UTSW	19	10627858	missense	probably damaging	1.00
X0050:Ddb1	UTSW	19	10626659	missense	possibly damaging	0.95
Z1088:Ddb1	UTSW	19	10619230	missense	probably damaging	0.99
Z1177:Ddb1	UTSW	19	10608396	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAAAATTTAAGTCAATGGGGCAAC -3'
(R):5'- CCTTACTACAGAGGCCACAG -3'

Sequencing Primer
(F):5'- CAACCAGGGGATACTCTT -3'
(R):5'- ATCTCTGAGTTCAAGGCAGC -3'

Posted On

2019-06-07