Incidental Mutation 'PIT4445001:Ddb1'
ID555442
Institutional Source Beutler Lab
Gene Symbol Ddb1
Ensembl Gene ENSMUSG00000024740
Gene Namedamage specific DNA binding protein 1
SynonymsDNA repair protein, p127-Ddb1, damage-specific DNA-binding protein, DNA repair
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4445001 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location10605625-10629813 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 10625970 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 881 (L881I)
Ref Sequence ENSEMBL: ENSMUSP00000025649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025649]
Predicted Effect probably damaging
Transcript: ENSMUST00000025649
AA Change: L881I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025649
Gene: ENSMUSG00000024740
AA Change: L881I

DomainStartEndE-ValueType
Pfam:MMS1_N 75 543 1.9e-122 PFAM
low complexity region 755 775 N/A INTRINSIC
Pfam:CPSF_A 788 1099 1e-92 PFAM
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 90.8%
  • 10x: 84.5%
  • 20x: 70.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the large subunit (p127) of the heterodimeric DNA damage-binding (DDB) complex while another protein (p48) forms the small subunit. This protein complex functions in nucleotide-excision repair and binds to DNA following UV damage. Defective activity of this complex causes the repair defect in patients with xeroderma pigmentosum complementation group E (XPE) - an autosomal recessive disorder characterized by photosensitivity and early onset of carcinomas. However, it remains for mutation analysis to demonstrate whether the defect in XPE patients is in this gene or the gene encoding the small subunit. In addition, Best vitelliform mascular dystrophy is mapped to the same region as this gene on 11q, but no sequence alternations of this gene are demonstrated in Best disease patients. The protein encoded by this gene also functions as an adaptor molecule for the cullin 4 (CUL4) ubiquitin E3 ligase complex by facilitating the binding of substrates to this complex and the ubiquitination of proteins. [provided by RefSeq, May 2012]
PHENOTYPE: Complete deletion of this gene results in embryonic lethality; conditional mutation causes increased apoptosis in the developing brain, and defects in lens formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,075,551 K419E probably damaging Het
Adam7 T A 14: 68,509,748 K587N possibly damaging Het
Agl T C 3: 116,771,460 M382V Het
Agpat3 A T 10: 78,274,093 F341I possibly damaging Het
Ampd2 A T 3: 108,075,012 L767Q probably damaging Het
Arhgap28 A T 17: 67,896,235 D124E possibly damaging Het
Arhgap32 T C 9: 32,260,856 L1644P probably damaging Het
Asic4 T C 1: 75,451,127 V99A probably benign Het
Asns T A 6: 7,689,277 N75I probably damaging Het
Atp10a A G 7: 58,803,467 D798G probably damaging Het
Atp8a1 A G 5: 67,622,660 V1145A Het
BC017158 A G 7: 128,276,534 V243A probably benign Het
Ccdc171 A G 4: 83,661,747 Q577R probably damaging Het
Cd247 T A 1: 165,861,036 D154E probably damaging Het
Ceacam1 A T 7: 25,476,456 N104K probably damaging Het
Chfr A G 5: 110,151,677 D312G possibly damaging Het
Dgkh A T 14: 78,575,942 I1032N possibly damaging Het
Efcab6 A T 15: 83,904,267 V942D probably benign Het
Fmo5 A G 3: 97,651,528 T435A probably benign Het
Fpr1 T C 17: 17,876,893 Q278R probably benign Het
Fzr1 C T 10: 81,369,394 W256* probably null Het
Gabrb1 T C 5: 72,108,782 S261P probably damaging Het
Galr2 G T 11: 116,281,648 A55S probably benign Het
Gbp2 A T 3: 142,637,466 K581N probably benign Het
Gm7682 T G 5: 94,448,507 W468G probably benign Het
Gria1 A T 11: 57,185,838 Y89F probably damaging Het
Ibsp T A 5: 104,302,304 I26N possibly damaging Het
Igf1r T C 7: 68,207,463 F1058L probably damaging Het
Ighv1-16 A C 12: 114,666,060 C36G probably benign Het
Igll1 T C 16: 16,860,919 T176A probably benign Het
Ilkap T C 1: 91,385,345 T143A probably benign Het
Kdm3b A T 18: 34,793,115 K103* probably null Het
Mphosph9 A G 5: 124,298,790 I497T possibly damaging Het
Mrgpra3 G A 7: 47,590,160 T6I possibly damaging Het
Mrpl38 T C 11: 116,132,558 probably null Het
Myo3a A T 2: 22,542,415 E813V possibly damaging Het
Myo7b G T 18: 31,959,466 Q2093K possibly damaging Het
Myo7b T C 18: 31,962,352 K1851R probably damaging Het
P3h2 T A 16: 25,984,999 D339V probably benign Het
Pcdhb6 C A 18: 37,335,247 P407Q possibly damaging Het
Plch2 C A 4: 155,009,026 R153L probably damaging Het
Plppr4 G A 3: 117,360,308 probably benign Het
Ppp1r3a A G 6: 14,717,777 F1046S probably damaging Het
Prkacb A T 3: 146,755,691 L107M probably benign Het
Ranbp17 A G 11: 33,481,020 probably null Het
Rasl11b C A 5: 74,197,333 P88Q probably damaging Het
Rcc2 A G 4: 140,721,149 E503G possibly damaging Het
Rnf216 T A 5: 143,086,003 K407N probably damaging Het
Scrn3 G A 2: 73,318,329 M81I possibly damaging Het
Scube2 T C 7: 109,809,180 T687A probably benign Het
Serpinb10 T A 1: 107,535,998 F3L probably benign Het
Sgcb C T 5: 73,639,812 V202I probably damaging Het
Sgce A G 6: 4,689,654 V429A possibly damaging Het
Sh3rf2 T C 18: 42,153,164 V574A probably benign Het
Sncaip T C 18: 52,868,944 L179S probably damaging Het
Sntg2 A T 12: 30,312,572 D58E probably damaging Het
Taar3 T C 10: 23,949,688 I44T possibly damaging Het
Tmem87b G A 2: 128,831,471 V227I probably benign Het
Tnfsf9 T C 17: 57,105,517 L29P possibly damaging Het
Tnip2 T C 5: 34,496,871 H391R probably benign Het
Traf5 A G 1: 191,997,807 Y125H Het
Ttc23 T G 7: 67,667,213 I77M probably damaging Het
Ube2l3 T C 16: 17,160,172 N43S probably benign Het
Vars2 A T 17: 35,666,211 C142* probably null Het
Vmn2r15 A C 5: 109,287,142 D565E probably damaging Het
Vmn2r56 C T 7: 12,715,226 probably null Het
Vmn2r79 A T 7: 87,002,200 D269V possibly damaging Het
Vmn2r85 A T 10: 130,425,703 M255K probably benign Het
Wfdc6a T A 2: 164,579,826 *137C probably null Het
Wipi2 T C 5: 142,666,884 V417A probably benign Het
Xirp2 G T 2: 67,509,772 V786L possibly damaging Het
Zdhhc13 G A 7: 48,795,949 G26S probably benign Het
Zscan25 T A 5: 145,290,612 V362D probably damaging Het
Other mutations in Ddb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Ddb1 APN 19 10611664 missense possibly damaging 0.85
IGL00742:Ddb1 APN 19 10610760 missense probably benign
IGL01161:Ddb1 APN 19 10605707 start codon destroyed probably null 1.00
IGL01364:Ddb1 APN 19 10627660 critical splice donor site probably null
IGL01804:Ddb1 APN 19 10613018 missense probably damaging 1.00
IGL01812:Ddb1 APN 19 10613018 missense probably damaging 1.00
IGL02523:Ddb1 APN 19 10627632 missense probably damaging 1.00
IGL02609:Ddb1 APN 19 10622466 missense possibly damaging 0.93
IGL02664:Ddb1 APN 19 10607883 missense probably benign
IGL03033:Ddb1 APN 19 10625926 missense possibly damaging 0.59
IGL03092:Ddb1 APN 19 10612945 missense probably damaging 1.00
IGL03110:Ddb1 APN 19 10612945 missense probably damaging 1.00
IGL03256:Ddb1 APN 19 10621861 missense probably benign 0.01
Dubitable UTSW 19 10622499 critical splice donor site probably null
Indubitable UTSW 19 10607911 critical splice donor site probably null
Van_der_waals UTSW 19 10612916 missense probably benign 0.11
R0028:Ddb1 UTSW 19 10619246 missense probably damaging 1.00
R0589:Ddb1 UTSW 19 10621716 missense probably benign 0.02
R0893:Ddb1 UTSW 19 10612916 missense probably benign 0.11
R1374:Ddb1 UTSW 19 10608318 missense probably damaging 1.00
R1611:Ddb1 UTSW 19 10612888 missense probably damaging 1.00
R1611:Ddb1 UTSW 19 10626764 critical splice donor site probably null
R1661:Ddb1 UTSW 19 10629080 missense probably benign 0.00
R1835:Ddb1 UTSW 19 10626593 missense probably damaging 1.00
R2036:Ddb1 UTSW 19 10610822 splice site probably benign
R2094:Ddb1 UTSW 19 10612936 missense probably benign
R2142:Ddb1 UTSW 19 10619126 critical splice donor site probably null
R2213:Ddb1 UTSW 19 10608327 missense probably damaging 1.00
R2318:Ddb1 UTSW 19 10626628 missense probably damaging 1.00
R2354:Ddb1 UTSW 19 10606973 missense probably benign 0.03
R3150:Ddb1 UTSW 19 10612982 missense probably benign 0.02
R3162:Ddb1 UTSW 19 10625971 missense probably damaging 0.99
R3162:Ddb1 UTSW 19 10625971 missense probably damaging 0.99
R3606:Ddb1 UTSW 19 10628493 missense probably damaging 1.00
R4050:Ddb1 UTSW 19 10627807 missense probably benign 0.00
R5157:Ddb1 UTSW 19 10622364 missense probably benign 0.01
R6244:Ddb1 UTSW 19 10625923 missense probably damaging 0.99
R6249:Ddb1 UTSW 19 10605720 nonsense probably null
R6812:Ddb1 UTSW 19 10622499 critical splice donor site probably null
R7337:Ddb1 UTSW 19 10627831 missense possibly damaging 0.88
R7460:Ddb1 UTSW 19 10607911 critical splice donor site probably null
R7737:Ddb1 UTSW 19 10625974 missense possibly damaging 0.93
R7903:Ddb1 UTSW 19 10608348 missense probably benign 0.12
R7986:Ddb1 UTSW 19 10608348 missense probably benign 0.12
RF016:Ddb1 UTSW 19 10627858 missense probably damaging 1.00
X0050:Ddb1 UTSW 19 10626659 missense possibly damaging 0.95
Z1088:Ddb1 UTSW 19 10619230 missense probably damaging 0.99
Z1177:Ddb1 UTSW 19 10608396 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAAATTTAAGTCAATGGGGCAAC -3'
(R):5'- CCTTACTACAGAGGCCACAG -3'

Sequencing Primer
(F):5'- CAACCAGGGGATACTCTT -3'
(R):5'- ATCTCTGAGTTCAAGGCAGC -3'
Posted On2019-06-07