Incidental Mutation 'PIT4403001:Plppr1'
ID555459
Institutional Source Beutler Lab
Gene Symbol Plppr1
Ensembl Gene ENSMUSG00000063446
Gene Namephospholipid phosphatase related 1
SynonymsPRG-3, E130309F12Rik, Lppr1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.295) question?
Stock #PIT4403001 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location49059273-49340259 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 49337648 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 316 (N316K)
Ref Sequence ENSEMBL: ENSMUSP00000075966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076670]
Predicted Effect probably benign
Transcript: ENSMUST00000076670
AA Change: N316K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000075966
Gene: ENSMUSG00000063446
AA Change: N316K

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
acidPPc 128 272 4.47e-16 SMART
Coding Region Coverage
  • 1x: 92.7%
  • 3x: 90.5%
  • 10x: 84.9%
  • 20x: 73.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plasticity-related gene (PRG) family. Members of the PRG family mediate lipid phosphate phosphatase activity in neurons and are known to be involved in neuronal plasticity. The protein encoded by this gene does not perform its function through enzymatic phospholipid degradation. This gene is strongly expressed in brain. It shows dynamic expression regulation during brain development and neuronal excitation. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik T C 8: 105,284,744 N253D probably benign Het
Adh4 T C 3: 138,424,178 V255A probably damaging Het
Ahnak T C 19: 9,006,176 I1608T possibly damaging Het
Atm A T 9: 53,500,982 D955E probably benign Het
Cacybp A G 1: 160,206,194 S113P probably damaging Het
Cenpu C T 8: 46,562,529 P160S possibly damaging Het
Clstn3 C T 6: 124,458,023 G348D probably damaging Het
Cmtr1 T G 17: 29,698,073 probably null Het
Dlgap2 T C 8: 14,831,528 S867P probably damaging Het
Fbn1 A T 2: 125,342,911 C1654S probably damaging Het
Fbxl3 G A 14: 103,095,464 T26M possibly damaging Het
Garnl3 A T 2: 32,990,758 L874Q probably damaging Het
Gcm2 A G 13: 41,102,839 V478A probably benign Het
Gm1527 T C 3: 28,917,985 I417T possibly damaging Het
Grip1 A G 10: 119,929,928 E55G probably damaging Het
Ighv1-4 A G 12: 114,487,204 S95P probably damaging Het
Jak3 C T 8: 71,684,349 T723I probably benign Het
Jup A G 11: 100,378,087 probably null Het
Kcng3 A G 17: 83,588,182 L285S probably damaging Het
Kmt2b G A 7: 30,585,689 P593S probably damaging Het
Mstn T C 1: 53,061,785 M7T probably benign Het
Myh2 A T 11: 67,186,707 K889N probably benign Het
Myo5a A G 9: 75,217,523 T1787A probably damaging Het
Nlrp14 A T 7: 107,184,892 Q607L possibly damaging Het
Ntf3 C T 6: 126,101,826 R239Q probably damaging Het
Nup85 G T 11: 115,581,820 R492L probably damaging Het
Ogfod3 A C 11: 121,196,735 probably null Het
Olfr1220 T A 2: 89,097,076 M284L probably benign Het
Olfr1286 A T 2: 111,420,820 F44I probably benign Het
Olfr26 T C 9: 38,855,380 I106T probably benign Het
Olfr347 T A 2: 36,734,918 I199K probably damaging Het
Olfr649 A G 7: 104,189,460 V249A probably benign Het
Oxct2a A T 4: 123,322,444 D381E probably damaging Het
Pcdh20 G C 14: 88,467,026 P946R probably damaging Het
Pdgfc C T 3: 81,174,961 P154S probably damaging Het
Phkg1 T C 5: 129,865,931 T260A probably benign Het
Pld4 T G 12: 112,767,822 L374R probably damaging Het
Plekhj1 C T 10: 80,796,459 D150N unknown Het
Pola2 A C 19: 5,959,046 S95A possibly damaging Het
Polq G A 16: 37,060,587 D1038N probably benign Het
Prim1 A T 10: 128,022,876 I218L probably benign Het
Prkcz A G 4: 155,293,156 probably null Het
Ptgr1 T C 4: 58,968,794 K282E probably benign Het
Rbm5 A G 9: 107,760,336 M132T probably damaging Het
Scn2a C T 2: 65,711,908 T785M probably damaging Het
Setx A G 2: 29,133,955 E141G probably damaging Het
Slc24a2 A G 4: 87,032,286 F425L probably benign Het
Smarcc2 A T 10: 128,463,024 H92L probably damaging Het
Tatdn1 C G 15: 58,905,747 E220Q probably damaging Het
Tmc7 T G 7: 118,547,401 Q488P possibly damaging Het
Tmc7 C A 7: 118,547,400 Q488H probably benign Het
Tmem45b C T 9: 31,426,892 D264N probably benign Het
Tmtc4 A C 14: 122,973,229 S72R probably benign Het
Tnc C A 4: 63,964,667 D1906Y probably damaging Het
Ubac1 A T 2: 26,006,597 M302K probably benign Het
Ubox5 A G 2: 130,600,677 I30T probably damaging Het
Vwce A G 19: 10,638,097 N114S possibly damaging Het
Xpo5 T A 17: 46,239,569 D992E probably benign Het
Zfhx2 G A 14: 55,074,980 P86S probably benign Het
Zfp335 T C 2: 164,893,716 H1106R possibly damaging Het
Zfp653 T A 9: 22,065,757 Q166L probably damaging Het
Zp3r T A 1: 130,582,872 N436I possibly damaging Het
Other mutations in Plppr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01980:Plppr1 APN 4 49319992 missense possibly damaging 0.88
R0605:Plppr1 UTSW 4 49323466 missense probably damaging 1.00
R1381:Plppr1 UTSW 4 49337674 missense possibly damaging 0.85
R1452:Plppr1 UTSW 4 49301067 splice site probably benign
R1682:Plppr1 UTSW 4 49325617 critical splice acceptor site probably null
R1980:Plppr1 UTSW 4 49337655 missense probably benign 0.09
R4261:Plppr1 UTSW 4 49300993 missense probably benign 0.09
R4674:Plppr1 UTSW 4 49323384 missense probably damaging 1.00
R5064:Plppr1 UTSW 4 49319974 missense probably benign 0.19
R5144:Plppr1 UTSW 4 49319800 missense possibly damaging 0.71
R7545:Plppr1 UTSW 4 49320002 missense possibly damaging 0.88
R7823:Plppr1 UTSW 4 49325703 missense probably benign 0.01
R8049:Plppr1 UTSW 4 49300942 missense probably benign
Z1177:Plppr1 UTSW 4 49319950 missense probably damaging 1.00
Z1177:Plppr1 UTSW 4 49319995 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTTGTTTAAGAGGGGACATGAAGC -3'
(R):5'- CAGGGCAAGCTACATCACTTC -3'

Sequencing Primer
(F):5'- TTTAAGAGGGGACATGAAGCTGAAG -3'
(R):5'- GGGCAAGCTACATCACTTCTTCATAC -3'
Posted On2019-06-07