Incidental Mutation 'PIT4403001:Tatdn1'
ID555498
Institutional Source Beutler Lab
Gene Symbol Tatdn1
Ensembl Gene ENSMUSG00000050891
Gene NameTatD DNase domain containing 1
SynonymsCDA11, 2310079P03Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #PIT4403001 (G1)
Quality Score156.008
Status Not validated
Chromosome15
Chromosomal Location58890155-58933738 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 58905747 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glutamine at position 220 (E220Q)
Ref Sequence ENSEMBL: ENSMUSP00000105783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036904] [ENSMUST00000110155] [ENSMUST00000226707] [ENSMUST00000226835] [ENSMUST00000227540] [ENSMUST00000228538] [ENSMUST00000228787]
Predicted Effect probably benign
Transcript: ENSMUST00000036904
SMART Domains Protein: ENSMUSP00000046467
Gene: ENSMUSG00000037075

DomainStartEndE-ValueType
Pfam:TRC8_N 19 516 5.1e-187 PFAM
RING 547 585 1.2e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110155
AA Change: E220Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105783
Gene: ENSMUSG00000050891
AA Change: E220Q

DomainStartEndE-ValueType
Pfam:TatD_DNase 7 263 2.4e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226707
Predicted Effect probably benign
Transcript: ENSMUST00000226835
Predicted Effect probably benign
Transcript: ENSMUST00000227540
Predicted Effect probably damaging
Transcript: ENSMUST00000228538
AA Change: E220Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000228787
Coding Region Coverage
  • 1x: 92.7%
  • 3x: 90.5%
  • 10x: 84.9%
  • 20x: 73.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik T C 8: 105,284,744 N253D probably benign Het
Adh4 T C 3: 138,424,178 V255A probably damaging Het
Ahnak T C 19: 9,006,176 I1608T possibly damaging Het
Atm A T 9: 53,500,982 D955E probably benign Het
Cacybp A G 1: 160,206,194 S113P probably damaging Het
Cenpu C T 8: 46,562,529 P160S possibly damaging Het
Clstn3 C T 6: 124,458,023 G348D probably damaging Het
Cmtr1 T G 17: 29,698,073 probably null Het
Dlgap2 T C 8: 14,831,528 S867P probably damaging Het
Fbn1 A T 2: 125,342,911 C1654S probably damaging Het
Fbxl3 G A 14: 103,095,464 T26M possibly damaging Het
Garnl3 A T 2: 32,990,758 L874Q probably damaging Het
Gcm2 A G 13: 41,102,839 V478A probably benign Het
Gm1527 T C 3: 28,917,985 I417T possibly damaging Het
Grip1 A G 10: 119,929,928 E55G probably damaging Het
Ighv1-4 A G 12: 114,487,204 S95P probably damaging Het
Jak3 C T 8: 71,684,349 T723I probably benign Het
Jup A G 11: 100,378,087 probably null Het
Kcng3 A G 17: 83,588,182 L285S probably damaging Het
Kmt2b G A 7: 30,585,689 P593S probably damaging Het
Mstn T C 1: 53,061,785 M7T probably benign Het
Myh2 A T 11: 67,186,707 K889N probably benign Het
Myo5a A G 9: 75,217,523 T1787A probably damaging Het
Nlrp14 A T 7: 107,184,892 Q607L possibly damaging Het
Ntf3 C T 6: 126,101,826 R239Q probably damaging Het
Nup85 G T 11: 115,581,820 R492L probably damaging Het
Ogfod3 A C 11: 121,196,735 probably null Het
Olfr1220 T A 2: 89,097,076 M284L probably benign Het
Olfr1286 A T 2: 111,420,820 F44I probably benign Het
Olfr26 T C 9: 38,855,380 I106T probably benign Het
Olfr347 T A 2: 36,734,918 I199K probably damaging Het
Olfr649 A G 7: 104,189,460 V249A probably benign Het
Oxct2a A T 4: 123,322,444 D381E probably damaging Het
Pcdh20 G C 14: 88,467,026 P946R probably damaging Het
Pdgfc C T 3: 81,174,961 P154S probably damaging Het
Phkg1 T C 5: 129,865,931 T260A probably benign Het
Pld4 T G 12: 112,767,822 L374R probably damaging Het
Plekhj1 C T 10: 80,796,459 D150N unknown Het
Plppr1 T G 4: 49,337,648 N316K probably benign Het
Pola2 A C 19: 5,959,046 S95A possibly damaging Het
Polq G A 16: 37,060,587 D1038N probably benign Het
Prim1 A T 10: 128,022,876 I218L probably benign Het
Prkcz A G 4: 155,293,156 probably null Het
Ptgr1 T C 4: 58,968,794 K282E probably benign Het
Rbm5 A G 9: 107,760,336 M132T probably damaging Het
Scn2a C T 2: 65,711,908 T785M probably damaging Het
Setx A G 2: 29,133,955 E141G probably damaging Het
Slc24a2 A G 4: 87,032,286 F425L probably benign Het
Smarcc2 A T 10: 128,463,024 H92L probably damaging Het
Tmc7 C A 7: 118,547,400 Q488H probably benign Het
Tmc7 T G 7: 118,547,401 Q488P possibly damaging Het
Tmem45b C T 9: 31,426,892 D264N probably benign Het
Tmtc4 A C 14: 122,973,229 S72R probably benign Het
Tnc C A 4: 63,964,667 D1906Y probably damaging Het
Ubac1 A T 2: 26,006,597 M302K probably benign Het
Ubox5 A G 2: 130,600,677 I30T probably damaging Het
Vwce A G 19: 10,638,097 N114S possibly damaging Het
Xpo5 T A 17: 46,239,569 D992E probably benign Het
Zfhx2 G A 14: 55,074,980 P86S probably benign Het
Zfp335 T C 2: 164,893,716 H1106R possibly damaging Het
Zfp653 T A 9: 22,065,757 Q166L probably damaging Het
Zp3r T A 1: 130,582,872 N436I possibly damaging Het
Other mutations in Tatdn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01141:Tatdn1 APN 15 58909567 intron probably benign
IGL03155:Tatdn1 APN 15 58916196 intron probably benign
R0417:Tatdn1 UTSW 15 58921350 missense probably benign 0.00
R1605:Tatdn1 UTSW 15 58921190 intron probably benign
R1823:Tatdn1 UTSW 15 58916156 missense probably damaging 1.00
R2267:Tatdn1 UTSW 15 58905752 missense probably damaging 1.00
R3923:Tatdn1 UTSW 15 58921171 missense possibly damaging 0.88
R6481:Tatdn1 UTSW 15 58923911 missense possibly damaging 0.49
R6912:Tatdn1 UTSW 15 58921269 splice site probably null
R7827:Tatdn1 UTSW 15 58904758 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAACTGCTTAGGGGACTCATTTC -3'
(R):5'- TACAATGTGCATGCAATGTGC -3'

Sequencing Primer
(F):5'- GGGGACTCATTTCATTAAATAGTCAG -3'
(R):5'- GCAATGTGCATACTTAATGTGTGAC -3'
Posted On2019-06-07