Incidental Mutation 'PIT4403001:Kcng3'
ID555502
Institutional Source Beutler Lab
Gene Symbol Kcng3
Ensembl Gene ENSMUSG00000045053
Gene Namepotassium voltage-gated channel, subfamily G, member 3
SynonymsKv10.1a, Kv10.1b, KV6.3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.241) question?
Stock #PIT4403001 (G1)
Quality Score142.008
Status Not validated
Chromosome17
Chromosomal Location83585957-83631895 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83588182 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 285 (L285S)
Ref Sequence ENSEMBL: ENSMUSP00000054910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051482]
Predicted Effect probably damaging
Transcript: ENSMUST00000051482
AA Change: L285S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054910
Gene: ENSMUSG00000045053
AA Change: L285S

DomainStartEndE-ValueType
BTB 9 119 5.2e-5 SMART
Pfam:Ion_trans 167 417 4.6e-42 PFAM
Pfam:Ion_trans_2 321 411 4.3e-13 PFAM
Coding Region Coverage
  • 1x: 92.7%
  • 3x: 90.5%
  • 10x: 84.9%
  • 20x: 73.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily G. This member is a gamma subunit functioning as a modulatory molecule. Alternative splicing results in two transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik T C 8: 105,284,744 N253D probably benign Het
Adh4 T C 3: 138,424,178 V255A probably damaging Het
Ahnak T C 19: 9,006,176 I1608T possibly damaging Het
Atm A T 9: 53,500,982 D955E probably benign Het
Cacybp A G 1: 160,206,194 S113P probably damaging Het
Cenpu C T 8: 46,562,529 P160S possibly damaging Het
Clstn3 C T 6: 124,458,023 G348D probably damaging Het
Cmtr1 T G 17: 29,698,073 probably null Het
Dlgap2 T C 8: 14,831,528 S867P probably damaging Het
Fbn1 A T 2: 125,342,911 C1654S probably damaging Het
Fbxl3 G A 14: 103,095,464 T26M possibly damaging Het
Garnl3 A T 2: 32,990,758 L874Q probably damaging Het
Gcm2 A G 13: 41,102,839 V478A probably benign Het
Gm1527 T C 3: 28,917,985 I417T possibly damaging Het
Grip1 A G 10: 119,929,928 E55G probably damaging Het
Ighv1-4 A G 12: 114,487,204 S95P probably damaging Het
Jak3 C T 8: 71,684,349 T723I probably benign Het
Jup A G 11: 100,378,087 probably null Het
Kmt2b G A 7: 30,585,689 P593S probably damaging Het
Mstn T C 1: 53,061,785 M7T probably benign Het
Myh2 A T 11: 67,186,707 K889N probably benign Het
Myo5a A G 9: 75,217,523 T1787A probably damaging Het
Nlrp14 A T 7: 107,184,892 Q607L possibly damaging Het
Ntf3 C T 6: 126,101,826 R239Q probably damaging Het
Nup85 G T 11: 115,581,820 R492L probably damaging Het
Ogfod3 A C 11: 121,196,735 probably null Het
Olfr1220 T A 2: 89,097,076 M284L probably benign Het
Olfr1286 A T 2: 111,420,820 F44I probably benign Het
Olfr26 T C 9: 38,855,380 I106T probably benign Het
Olfr347 T A 2: 36,734,918 I199K probably damaging Het
Olfr649 A G 7: 104,189,460 V249A probably benign Het
Oxct2a A T 4: 123,322,444 D381E probably damaging Het
Pcdh20 G C 14: 88,467,026 P946R probably damaging Het
Pdgfc C T 3: 81,174,961 P154S probably damaging Het
Phkg1 T C 5: 129,865,931 T260A probably benign Het
Pld4 T G 12: 112,767,822 L374R probably damaging Het
Plekhj1 C T 10: 80,796,459 D150N unknown Het
Plppr1 T G 4: 49,337,648 N316K probably benign Het
Pola2 A C 19: 5,959,046 S95A possibly damaging Het
Polq G A 16: 37,060,587 D1038N probably benign Het
Prim1 A T 10: 128,022,876 I218L probably benign Het
Prkcz A G 4: 155,293,156 probably null Het
Ptgr1 T C 4: 58,968,794 K282E probably benign Het
Rbm5 A G 9: 107,760,336 M132T probably damaging Het
Scn2a C T 2: 65,711,908 T785M probably damaging Het
Setx A G 2: 29,133,955 E141G probably damaging Het
Slc24a2 A G 4: 87,032,286 F425L probably benign Het
Smarcc2 A T 10: 128,463,024 H92L probably damaging Het
Tatdn1 C G 15: 58,905,747 E220Q probably damaging Het
Tmc7 C A 7: 118,547,400 Q488H probably benign Het
Tmc7 T G 7: 118,547,401 Q488P possibly damaging Het
Tmem45b C T 9: 31,426,892 D264N probably benign Het
Tmtc4 A C 14: 122,973,229 S72R probably benign Het
Tnc C A 4: 63,964,667 D1906Y probably damaging Het
Ubac1 A T 2: 26,006,597 M302K probably benign Het
Ubox5 A G 2: 130,600,677 I30T probably damaging Het
Vwce A G 19: 10,638,097 N114S possibly damaging Het
Xpo5 T A 17: 46,239,569 D992E probably benign Het
Zfhx2 G A 14: 55,074,980 P86S probably benign Het
Zfp335 T C 2: 164,893,716 H1106R possibly damaging Het
Zfp653 T A 9: 22,065,757 Q166L probably damaging Het
Zp3r T A 1: 130,582,872 N436I possibly damaging Het
Other mutations in Kcng3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01960:Kcng3 APN 17 83587850 missense probably damaging 1.00
R0034:Kcng3 UTSW 17 83588383 splice site probably benign
R0056:Kcng3 UTSW 17 83587756 missense probably damaging 0.98
R0335:Kcng3 UTSW 17 83587737 missense possibly damaging 0.51
R1224:Kcng3 UTSW 17 83631395 missense probably damaging 1.00
R1462:Kcng3 UTSW 17 83631063 missense probably damaging 0.96
R1601:Kcng3 UTSW 17 83588339 missense probably damaging 1.00
R3147:Kcng3 UTSW 17 83588320 missense possibly damaging 0.71
R4854:Kcng3 UTSW 17 83588306 missense probably damaging 0.97
R5408:Kcng3 UTSW 17 83631005 missense probably benign 0.12
R5719:Kcng3 UTSW 17 83631134 missense possibly damaging 0.71
R5791:Kcng3 UTSW 17 83588210 missense probably benign 0.02
R6155:Kcng3 UTSW 17 83588378 missense probably benign
R6437:Kcng3 UTSW 17 83631129 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGGCGAAATCCTTGTTGG -3'
(R):5'- TATCTGCATAGGGTGGTTCAC -3'

Sequencing Primer
(F):5'- AGGTCCAGCCCATGTTCAAG -3'
(R):5'- TTCACCGCGGAGTGCATC -3'
Posted On2019-06-07