Incidental Mutation 'PIT4402001:Igsf3'
ID555512
Institutional Source Beutler Lab
Gene Symbol Igsf3
Ensembl Gene ENSMUSG00000042035
Gene Nameimmunoglobulin superfamily, member 3
Synonyms1700016K10Rik, 4833439O17Rik, 2810035F16Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.352) question?
Stock #PIT4402001 (G1)
Quality Score182.009
Status Not validated
Chromosome3
Chromosomal Location101377083-101463059 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101427077 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 157 (K157E)
Ref Sequence ENSEMBL: ENSMUSP00000048900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043983] [ENSMUST00000195164]
Predicted Effect probably benign
Transcript: ENSMUST00000043983
AA Change: K157E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000048900
Gene: ENSMUSG00000042035
AA Change: K157E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 142 7.7e-5 SMART
IG 152 275 1.99e-7 SMART
IG 287 405 1.79e0 SMART
IG 417 539 6.26e-5 SMART
IG 553 674 3.16e-1 SMART
IG 686 811 4.89e-7 SMART
IG 823 947 8.38e-6 SMART
IG 959 1109 6.97e-3 SMART
transmembrane domain 1125 1147 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195164
AA Change: K157E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000141823
Gene: ENSMUSG00000042035
AA Change: K157E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 142 3.1e-7 SMART
IG 152 275 8.2e-10 SMART
IG 287 405 7.4e-3 SMART
IG 437 559 2.5e-7 SMART
IG 573 694 1.3e-3 SMART
IG 706 831 1.9e-9 SMART
IG 843 967 3.4e-8 SMART
IG 979 1129 2.9e-5 SMART
transmembrane domain 1145 1167 N/A INTRINSIC
Coding Region Coverage
  • 1x: 92.8%
  • 3x: 90.3%
  • 10x: 83.2%
  • 20x: 68.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an immunoglobulin-like membrane protein containing several V-type Ig-like domains. A mutation in this gene has been associated with bilateral nasolacrimal duct obstruction (LCDD). [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T G 14: 59,142,635 L71F probably damaging Het
Adamts9 C T 6: 92,872,347 V1044I probably benign Het
Alcam T C 16: 52,295,134 Y207C probably damaging Het
Aldh4a1 C A 4: 139,642,191 S351* probably null Het
Aoah C A 13: 20,794,510 S39R probably benign Het
Arcn1 A T 9: 44,745,602 V421E possibly damaging Het
Ccdc18 A G 5: 108,158,619 E300G possibly damaging Het
Cdk2ap2 C A 19: 4,098,557 R126S probably damaging Het
Dcun1d4 A G 5: 73,510,933 I39V probably benign Het
Fam53b A T 7: 132,760,017 I94N probably damaging Het
Fam83g A G 11: 61,703,596 H652R probably damaging Het
Fanca A T 8: 123,313,064 M157K possibly damaging Het
Flt1 A T 5: 147,678,239 I299N probably damaging Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gns A G 10: 121,376,706 Y191C probably damaging Het
Grin2a T C 16: 9,644,199 T690A possibly damaging Het
Gsk3b C T 16: 38,089,401 probably benign Het
Igsf10 A G 3: 59,325,579 V1911A probably benign Het
Inpp5a T C 7: 139,511,453 Y118H probably benign Het
Kmt2a A G 9: 44,841,062 V1413A unknown Het
Mettl9 T A 7: 121,057,217 V190E probably damaging Het
Mrps9 T C 1: 42,896,098 L188P probably benign Het
Myo9a A T 9: 59,870,436 R1158S possibly damaging Het
Nacad T G 11: 6,598,621 Q1371P probably benign Het
Ncoa1 T C 12: 4,294,987 M787V probably benign Het
Noxred1 A T 12: 87,227,081 I62K probably benign Het
Olfr1390 A G 11: 49,341,399 Y289C probably damaging Het
Olfr1532-ps1 T A 7: 106,915,087 D296E possibly damaging Het
Olfr350 A T 2: 36,850,304 H86L probably benign Het
Olfr646 A G 7: 104,106,450 Y57C probably damaging Het
Otud6b A G 4: 14,818,185 Y239H probably damaging Het
Pank1 A G 19: 34,840,966 Y233H probably damaging Het
Pccb G T 9: 100,995,592 D286E probably benign Het
Plek A C 11: 16,990,121 L196R probably benign Het
Pou6f2 T C 13: 18,125,346 H576R Het
Rbm47 T A 5: 66,027,011 Y83F probably damaging Het
Rbm6 A T 9: 107,787,850 Y787N probably damaging Het
Slc8a2 C A 7: 16,134,494 A217E probably damaging Het
Suox G A 10: 128,671,295 A288V probably damaging Het
Tbccd1 T C 16: 22,822,123 I501M probably damaging Het
Tjp2 C A 19: 24,098,129 G1042* probably null Het
Tmtc2 T C 10: 105,413,407 Y155C probably damaging Het
Usp7 T C 16: 8,698,495 N600S probably benign Het
Zer1 T C 2: 30,101,120 I699V probably damaging Het
Zfp142 A G 1: 74,579,528 F227S probably damaging Het
Other mutations in Igsf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Igsf3 APN 3 101431239 missense probably damaging 0.99
IGL00907:Igsf3 APN 3 101427448 splice site probably benign
IGL01321:Igsf3 APN 3 101427022 splice site probably benign
IGL01340:Igsf3 APN 3 101439679 nonsense probably null
IGL02291:Igsf3 APN 3 101439529 missense probably damaging 1.00
R0090:Igsf3 UTSW 3 101435652 missense probably damaging 1.00
R0143:Igsf3 UTSW 3 101435601 missense probably damaging 1.00
R0418:Igsf3 UTSW 3 101435435 missense probably damaging 0.99
R0711:Igsf3 UTSW 3 101427393 missense probably benign 0.31
R1195:Igsf3 UTSW 3 101458103 missense probably benign 0.05
R1195:Igsf3 UTSW 3 101458103 missense probably benign 0.05
R1195:Igsf3 UTSW 3 101458103 missense probably benign 0.05
R1384:Igsf3 UTSW 3 101451296 critical splice donor site probably null
R1594:Igsf3 UTSW 3 101451077 nonsense probably null
R1624:Igsf3 UTSW 3 101455227 missense probably benign 0.37
R1766:Igsf3 UTSW 3 101431282 missense probably damaging 1.00
R1988:Igsf3 UTSW 3 101431296 missense probably benign 0.03
R2072:Igsf3 UTSW 3 101439515 missense probably benign 0.02
R4707:Igsf3 UTSW 3 101458094 missense probably benign 0.06
R4976:Igsf3 UTSW 3 101439361 splice site probably null
R4982:Igsf3 UTSW 3 101435667 missense probably benign 0.42
R5008:Igsf3 UTSW 3 101450917 missense probably damaging 0.97
R5119:Igsf3 UTSW 3 101439361 splice site probably null
R5189:Igsf3 UTSW 3 101431527 missense possibly damaging 0.64
R5456:Igsf3 UTSW 3 101427221 missense probably benign 0.20
R5776:Igsf3 UTSW 3 101425480 missense probably benign 0.01
R6112:Igsf3 UTSW 3 101451006 missense probably damaging 1.00
R6383:Igsf3 UTSW 3 101435648 missense probably benign 0.05
R6758:Igsf3 UTSW 3 101425498 missense probably damaging 0.98
R7085:Igsf3 UTSW 3 101455489 missense probably benign 0.12
R7310:Igsf3 UTSW 3 101431579 missense probably benign 0.01
R7470:Igsf3 UTSW 3 101451075 missense possibly damaging 0.67
R7707:Igsf3 UTSW 3 101459922 missense probably benign 0.00
R7719:Igsf3 UTSW 3 101435541 missense probably damaging 1.00
R7739:Igsf3 UTSW 3 101435531 missense probably damaging 1.00
X0027:Igsf3 UTSW 3 101435645 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATCCCAAGCAAGTGTCAG -3'
(R):5'- GAGACGAAAGGTGCTTCTCC -3'

Sequencing Primer
(F):5'- TCCCTCCATGGGAACATT -3'
(R):5'- AAAGGTGCTTCTCCCCAGC -3'
Posted On2019-06-07