Incidental Mutation 'PIT4402001:Dcun1d4'
ID555516
Institutional Source Beutler Lab
Gene Symbol Dcun1d4
Ensembl Gene ENSMUSG00000051674
Gene NameDCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock #PIT4402001 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location73481000-73560794 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73510933 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 39 (I39V)
Ref Sequence ENSEMBL: ENSMUSP00000084427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063882] [ENSMUST00000087181] [ENSMUST00000113558] [ENSMUST00000133137] [ENSMUST00000134092] [ENSMUST00000136268] [ENSMUST00000141553] [ENSMUST00000145645] [ENSMUST00000156806]
Predicted Effect probably benign
Transcript: ENSMUST00000063882
AA Change: I25V

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000067616
Gene: ENSMUSG00000051674
AA Change: I25V

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
Pfam:Cullin_binding 173 287 3.4e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000087181
AA Change: I39V

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000084427
Gene: ENSMUSG00000051674
AA Change: I39V

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
Pfam:Cullin_binding 189 300 1.3e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113558
AA Change: I25V

PolyPhen 2 Score 0.322 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000109187
Gene: ENSMUSG00000051674
AA Change: I25V

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
Pfam:Cullin_binding 203 252 2e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000133137
AA Change: I25V

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120055
Gene: ENSMUSG00000051674
AA Change: I25V

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000134092
AA Change: I25V

PolyPhen 2 Score 0.649 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000118710
Gene: ENSMUSG00000051674
AA Change: I25V

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136268
SMART Domains Protein: ENSMUSP00000119983
Gene: ENSMUSG00000051674

DomainStartEndE-ValueType
PDB:4GBA|B 42 104 2e-8 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000141553
Predicted Effect probably benign
Transcript: ENSMUST00000145645
SMART Domains Protein: ENSMUSP00000122689
Gene: ENSMUSG00000051674

DomainStartEndE-ValueType
PDB:4GBA|B 42 101 1e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000156806
Coding Region Coverage
  • 1x: 92.8%
  • 3x: 90.3%
  • 10x: 83.2%
  • 20x: 68.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T G 14: 59,142,635 L71F probably damaging Het
Adamts9 C T 6: 92,872,347 V1044I probably benign Het
Alcam T C 16: 52,295,134 Y207C probably damaging Het
Aldh4a1 C A 4: 139,642,191 S351* probably null Het
Aoah C A 13: 20,794,510 S39R probably benign Het
Arcn1 A T 9: 44,745,602 V421E possibly damaging Het
Ccdc18 A G 5: 108,158,619 E300G possibly damaging Het
Cdk2ap2 C A 19: 4,098,557 R126S probably damaging Het
Fam53b A T 7: 132,760,017 I94N probably damaging Het
Fam83g A G 11: 61,703,596 H652R probably damaging Het
Fanca A T 8: 123,313,064 M157K possibly damaging Het
Flt1 A T 5: 147,678,239 I299N probably damaging Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gns A G 10: 121,376,706 Y191C probably damaging Het
Grin2a T C 16: 9,644,199 T690A possibly damaging Het
Gsk3b C T 16: 38,089,401 probably benign Het
Igsf10 A G 3: 59,325,579 V1911A probably benign Het
Igsf3 A G 3: 101,427,077 K157E probably benign Het
Inpp5a T C 7: 139,511,453 Y118H probably benign Het
Kmt2a A G 9: 44,841,062 V1413A unknown Het
Mettl9 T A 7: 121,057,217 V190E probably damaging Het
Mrps9 T C 1: 42,896,098 L188P probably benign Het
Myo9a A T 9: 59,870,436 R1158S possibly damaging Het
Nacad T G 11: 6,598,621 Q1371P probably benign Het
Ncoa1 T C 12: 4,294,987 M787V probably benign Het
Noxred1 A T 12: 87,227,081 I62K probably benign Het
Olfr1390 A G 11: 49,341,399 Y289C probably damaging Het
Olfr1532-ps1 T A 7: 106,915,087 D296E possibly damaging Het
Olfr350 A T 2: 36,850,304 H86L probably benign Het
Olfr646 A G 7: 104,106,450 Y57C probably damaging Het
Otud6b A G 4: 14,818,185 Y239H probably damaging Het
Pank1 A G 19: 34,840,966 Y233H probably damaging Het
Pccb G T 9: 100,995,592 D286E probably benign Het
Plek A C 11: 16,990,121 L196R probably benign Het
Pou6f2 T C 13: 18,125,346 H576R Het
Rbm47 T A 5: 66,027,011 Y83F probably damaging Het
Rbm6 A T 9: 107,787,850 Y787N probably damaging Het
Slc8a2 C A 7: 16,134,494 A217E probably damaging Het
Suox G A 10: 128,671,295 A288V probably damaging Het
Tbccd1 T C 16: 22,822,123 I501M probably damaging Het
Tjp2 C A 19: 24,098,129 G1042* probably null Het
Tmtc2 T C 10: 105,413,407 Y155C probably damaging Het
Usp7 T C 16: 8,698,495 N600S probably benign Het
Zer1 T C 2: 30,101,120 I699V probably damaging Het
Zfp142 A G 1: 74,579,528 F227S probably damaging Het
Other mutations in Dcun1d4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02194:Dcun1d4 APN 5 73481201 splice site probably benign
IGL02345:Dcun1d4 APN 5 73511152 missense probably damaging 0.99
IGL03264:Dcun1d4 APN 5 73520229 missense probably benign 0.00
R1184:Dcun1d4 UTSW 5 73511112 splice site probably benign
R2266:Dcun1d4 UTSW 5 73481275 splice site probably benign
R2267:Dcun1d4 UTSW 5 73481275 splice site probably benign
R2268:Dcun1d4 UTSW 5 73481275 splice site probably benign
R2269:Dcun1d4 UTSW 5 73481275 splice site probably benign
R4027:Dcun1d4 UTSW 5 73534637 missense probably damaging 0.97
R4029:Dcun1d4 UTSW 5 73534637 missense probably damaging 0.97
R4031:Dcun1d4 UTSW 5 73534637 missense probably damaging 0.97
R4788:Dcun1d4 UTSW 5 73534628 missense probably damaging 1.00
R4961:Dcun1d4 UTSW 5 73544120 nonsense probably null
R5245:Dcun1d4 UTSW 5 73557314 missense probably benign 0.11
R5284:Dcun1d4 UTSW 5 73522682 unclassified probably null
R5457:Dcun1d4 UTSW 5 73531565 missense probably damaging 1.00
R5728:Dcun1d4 UTSW 5 73520148 missense possibly damaging 0.61
R6469:Dcun1d4 UTSW 5 73534614 missense probably damaging 0.99
R6813:Dcun1d4 UTSW 5 73520957 missense possibly damaging 0.90
R7165:Dcun1d4 UTSW 5 73491195 splice site probably null
R7439:Dcun1d4 UTSW 5 73491536 critical splice donor site probably null
X0063:Dcun1d4 UTSW 5 73555438 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTTGTAAGTGTCCTGCTAG -3'
(R):5'- TGATCGTCTTGGCCAACGTC -3'

Sequencing Primer
(F):5'- GTCGAGCTACTAGGACAACTATACG -3'
(R):5'- CAACGTCTTCTGTCAGATTCTGTAAG -3'
Posted On2019-06-07