Incidental Mutation 'PIT4402001:Adamts9'
ID555519
Institutional Source Beutler Lab
Gene Symbol Adamts9
Ensembl Gene ENSMUSG00000030022
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 9
Synonyms8430403M15Rik, E030027K14Rik, 1810011L16Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4402001 (G1)
Quality Score137.008
Status Not validated
Chromosome6
Chromosomal Location92772699-92943492 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 92872347 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 1044 (V1044I)
Ref Sequence ENSEMBL: ENSMUSP00000109065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113434] [ENSMUST00000113438] [ENSMUST00000167391]
Predicted Effect probably benign
Transcript: ENSMUST00000113434
Predicted Effect probably benign
Transcript: ENSMUST00000113438
AA Change: V1044I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109065
Gene: ENSMUSG00000030022
AA Change: V1044I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 49 207 1.8e-37 PFAM
low complexity region 234 247 N/A INTRINSIC
Pfam:Reprolysin_5 291 476 7.6e-17 PFAM
Pfam:Reprolysin_4 291 495 2e-11 PFAM
Pfam:Reprolysin 293 499 7.4e-29 PFAM
Pfam:Reprolysin_2 310 489 1e-13 PFAM
Pfam:Reprolysin_3 314 445 1.7e-14 PFAM
TSP1 591 643 2.15e-9 SMART
Pfam:ADAM_spacer1 753 871 7.3e-35 PFAM
TSP1 881 936 1.14e0 SMART
Blast:TSP1 938 993 2e-28 BLAST
TSP1 1000 1054 3.78e-5 SMART
TSP1 1055 1109 5.64e-4 SMART
TSP1 1110 1166 1.25e-5 SMART
TSP1 1186 1240 1.45e-6 SMART
TSP1 1242 1296 4.41e-6 SMART
TSP1 1328 1380 7.06e-5 SMART
TSP1 1381 1436 4.24e-8 SMART
TSP1 1440 1495 8.23e-6 SMART
TSP1 1496 1551 1.23e-4 SMART
TSP1 1552 1609 2e-4 SMART
TSP1 1611 1672 1.25e-5 SMART
TSP1 1676 1730 3.47e-4 SMART
Pfam:GON 1732 1930 1.6e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167391
AA Change: V463I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126498
Gene: ENSMUSG00000030022
AA Change: V463I

DomainStartEndE-ValueType
TSP1 10 62 2.15e-9 SMART
Pfam:ADAM_spacer1 172 290 6.1e-35 PFAM
TSP1 300 355 1.14e0 SMART
Blast:TSP1 357 412 3e-28 BLAST
TSP1 419 473 3.78e-5 SMART
TSP1 474 528 5.64e-4 SMART
TSP1 529 585 1.25e-5 SMART
TSP1 605 659 1.45e-6 SMART
TSP1 661 715 4.41e-6 SMART
TSP1 747 799 7.06e-5 SMART
TSP1 800 855 4.24e-8 SMART
TSP1 859 914 8.23e-6 SMART
TSP1 915 970 1.23e-4 SMART
TSP1 971 1028 2e-4 SMART
TSP1 1030 1091 1.25e-5 SMART
TSP1 1095 1149 3.47e-4 SMART
Pfam:GON 1150 1350 2.1e-86 PFAM
Coding Region Coverage
  • 1x: 92.8%
  • 3x: 90.3%
  • 10x: 83.2%
  • 20x: 68.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. Members of the ADAMTS family have been implicated in the cleavage of proteoglycans, the control of organ shape during development, and the inhibition of angiogenesis. This gene is localized to chromosome 3p14.3-p14.2, an area known to be lost in hereditary renal tumors. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T G 14: 59,142,635 L71F probably damaging Het
Alcam T C 16: 52,295,134 Y207C probably damaging Het
Aldh4a1 C A 4: 139,642,191 S351* probably null Het
Aoah C A 13: 20,794,510 S39R probably benign Het
Arcn1 A T 9: 44,745,602 V421E possibly damaging Het
Ccdc18 A G 5: 108,158,619 E300G possibly damaging Het
Cdk2ap2 C A 19: 4,098,557 R126S probably damaging Het
Dcun1d4 A G 5: 73,510,933 I39V probably benign Het
Fam53b A T 7: 132,760,017 I94N probably damaging Het
Fam83g A G 11: 61,703,596 H652R probably damaging Het
Fanca A T 8: 123,313,064 M157K possibly damaging Het
Flt1 A T 5: 147,678,239 I299N probably damaging Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gns A G 10: 121,376,706 Y191C probably damaging Het
Grin2a T C 16: 9,644,199 T690A possibly damaging Het
Gsk3b C T 16: 38,089,401 probably benign Het
Igsf10 A G 3: 59,325,579 V1911A probably benign Het
Igsf3 A G 3: 101,427,077 K157E probably benign Het
Inpp5a T C 7: 139,511,453 Y118H probably benign Het
Kmt2a A G 9: 44,841,062 V1413A unknown Het
Mettl9 T A 7: 121,057,217 V190E probably damaging Het
Mrps9 T C 1: 42,896,098 L188P probably benign Het
Myo9a A T 9: 59,870,436 R1158S possibly damaging Het
Nacad T G 11: 6,598,621 Q1371P probably benign Het
Ncoa1 T C 12: 4,294,987 M787V probably benign Het
Noxred1 A T 12: 87,227,081 I62K probably benign Het
Olfr1390 A G 11: 49,341,399 Y289C probably damaging Het
Olfr1532-ps1 T A 7: 106,915,087 D296E possibly damaging Het
Olfr350 A T 2: 36,850,304 H86L probably benign Het
Olfr646 A G 7: 104,106,450 Y57C probably damaging Het
Otud6b A G 4: 14,818,185 Y239H probably damaging Het
Pank1 A G 19: 34,840,966 Y233H probably damaging Het
Pccb G T 9: 100,995,592 D286E probably benign Het
Plek A C 11: 16,990,121 L196R probably benign Het
Pou6f2 T C 13: 18,125,346 H576R Het
Rbm47 T A 5: 66,027,011 Y83F probably damaging Het
Rbm6 A T 9: 107,787,850 Y787N probably damaging Het
Slc8a2 C A 7: 16,134,494 A217E probably damaging Het
Suox G A 10: 128,671,295 A288V probably damaging Het
Tbccd1 T C 16: 22,822,123 I501M probably damaging Het
Tjp2 C A 19: 24,098,129 G1042* probably null Het
Tmtc2 T C 10: 105,413,407 Y155C probably damaging Het
Usp7 T C 16: 8,698,495 N600S probably benign Het
Zer1 T C 2: 30,101,120 I699V probably damaging Het
Zfp142 A G 1: 74,579,528 F227S probably damaging Het
Other mutations in Adamts9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Adamts9 APN 6 92859902 missense possibly damaging 0.90
IGL01352:Adamts9 APN 6 92860174 missense probably benign 0.00
IGL01462:Adamts9 APN 6 92894266 missense probably benign 0.04
IGL01551:Adamts9 APN 6 92807020 missense probably damaging 0.99
IGL01577:Adamts9 APN 6 92858147 splice site probably benign
IGL01638:Adamts9 APN 6 92872428 missense probably benign 0.19
IGL01757:Adamts9 APN 6 92796159 missense probably damaging 1.00
IGL02102:Adamts9 APN 6 92777439 missense probably benign 0.00
IGL02379:Adamts9 APN 6 92797033 missense probably damaging 0.97
IGL02419:Adamts9 APN 6 92796997 missense probably benign 0.04
IGL02554:Adamts9 APN 6 92880847 missense probably benign 0.01
IGL02832:Adamts9 APN 6 92807175 missense probably damaging 1.00
IGL03164:Adamts9 APN 6 92889937 missense probably damaging 1.00
IGL03347:Adamts9 APN 6 92887432 nonsense probably null
IGL03401:Adamts9 APN 6 92786868 missense probably damaging 0.97
Bluebeard UTSW 6 92879959 nonsense probably null
PIT4458001:Adamts9 UTSW 6 92889905 missense probably damaging 0.99
R0047:Adamts9 UTSW 6 92905306 unclassified probably benign
R0047:Adamts9 UTSW 6 92905306 unclassified probably benign
R0067:Adamts9 UTSW 6 92890167 missense probably damaging 0.98
R0141:Adamts9 UTSW 6 92943085 missense probably benign
R0326:Adamts9 UTSW 6 92858057 nonsense probably null
R0396:Adamts9 UTSW 6 92798005 missense probably benign 0.00
R0490:Adamts9 UTSW 6 92872866 missense probably benign
R0504:Adamts9 UTSW 6 92912645 missense probably damaging 1.00
R0620:Adamts9 UTSW 6 92858113 missense possibly damaging 0.95
R0669:Adamts9 UTSW 6 92880957 missense probably damaging 1.00
R0682:Adamts9 UTSW 6 92903802 missense possibly damaging 0.80
R1412:Adamts9 UTSW 6 92796433 missense probably benign
R1433:Adamts9 UTSW 6 92849290 critical splice donor site probably null
R1558:Adamts9 UTSW 6 92908711 missense possibly damaging 0.87
R1661:Adamts9 UTSW 6 92880623 missense possibly damaging 0.92
R1801:Adamts9 UTSW 6 92863376 missense probably benign 0.27
R1855:Adamts9 UTSW 6 92901369 splice site probably benign
R1887:Adamts9 UTSW 6 92872788 critical splice donor site probably null
R1934:Adamts9 UTSW 6 92943121 missense possibly damaging 0.59
R1956:Adamts9 UTSW 6 92859849 missense probably damaging 1.00
R1986:Adamts9 UTSW 6 92796394 missense probably benign
R2370:Adamts9 UTSW 6 92860203 missense probably damaging 0.99
R2376:Adamts9 UTSW 6 92912831 missense probably benign
R2432:Adamts9 UTSW 6 92857900 missense probably damaging 1.00
R2876:Adamts9 UTSW 6 92795910 splice site probably benign
R3015:Adamts9 UTSW 6 92872932 missense probably benign 0.05
R3611:Adamts9 UTSW 6 92869984 missense probably benign 0.05
R4024:Adamts9 UTSW 6 92872784 splice site probably benign
R4292:Adamts9 UTSW 6 92795996 missense possibly damaging 0.95
R4403:Adamts9 UTSW 6 92859864 missense probably damaging 1.00
R4574:Adamts9 UTSW 6 92879959 nonsense probably null
R4677:Adamts9 UTSW 6 92816606 start codon destroyed probably null
R5114:Adamts9 UTSW 6 92890273 missense probably benign 0.03
R5260:Adamts9 UTSW 6 92807137 missense probably benign 0.00
R5384:Adamts9 UTSW 6 92798018 missense probably damaging 1.00
R5423:Adamts9 UTSW 6 92880697 missense possibly damaging 0.84
R5497:Adamts9 UTSW 6 92854365 missense probably damaging 1.00
R5629:Adamts9 UTSW 6 92798133 missense probably damaging 1.00
R5943:Adamts9 UTSW 6 92903786 missense probably benign 0.02
R6039:Adamts9 UTSW 6 92908546 missense possibly damaging 0.95
R6039:Adamts9 UTSW 6 92908546 missense possibly damaging 0.95
R6051:Adamts9 UTSW 6 92859926 missense possibly damaging 0.83
R6051:Adamts9 UTSW 6 92890118 missense probably damaging 1.00
R6082:Adamts9 UTSW 6 92889949 missense probably damaging 1.00
R6192:Adamts9 UTSW 6 92797021 missense probably damaging 1.00
R6291:Adamts9 UTSW 6 92890120 missense probably damaging 1.00
R6502:Adamts9 UTSW 6 92872335 missense probably damaging 1.00
R6818:Adamts9 UTSW 6 92905191 missense probably damaging 1.00
R6848:Adamts9 UTSW 6 92863354 missense possibly damaging 0.84
R7028:Adamts9 UTSW 6 92909793 nonsense probably null
R7095:Adamts9 UTSW 6 92887691 missense probably benign 0.39
R7287:Adamts9 UTSW 6 92890003 missense possibly damaging 0.89
R7294:Adamts9 UTSW 6 92894289 missense probably damaging 1.00
R7313:Adamts9 UTSW 6 92858121 missense probably damaging 1.00
R7581:Adamts9 UTSW 6 92937338 missense probably benign 0.00
R7682:Adamts9 UTSW 6 92880698 missense possibly damaging 0.57
R7691:Adamts9 UTSW 6 92796238 missense probably damaging 1.00
R7791:Adamts9 UTSW 6 92872385 missense probably benign 0.00
R7851:Adamts9 UTSW 6 92908706 missense probably damaging 1.00
R7934:Adamts9 UTSW 6 92908706 missense probably damaging 1.00
RF013:Adamts9 UTSW 6 92943145 missense possibly damaging 0.88
Z1177:Adamts9 UTSW 6 92854346 missense not run
Predicted Primers PCR Primer
(F):5'- CAGCCAACTCCTAGTGACTC -3'
(R):5'- GGCTGAAAGAAACAACATAGCTTTG -3'

Sequencing Primer
(F):5'- CCCTAGGCAGACTAAAGGGTTTC -3'
(R):5'- CTAGAAGCTGTGATGGTG -3'
Posted On2019-06-07