Incidental Mutation 'PIT4402001:Olfr646'
ID555521
Institutional Source Beutler Lab
Gene Symbol Olfr646
Ensembl Gene ENSMUSG00000073931
Gene Nameolfactory receptor 646
SynonymsGA_x6K02T2PBJ9-6841330-6842268, MOR33-2
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.614) question?
Stock #PIT4402001 (G1)
Quality Score143.008
Status Not validated
Chromosome7
Chromosomal Location104104873-104109766 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104106450 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 57 (Y57C)
Ref Sequence ENSEMBL: ENSMUSP00000149102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098182] [ENSMUST00000138055] [ENSMUST00000214099]
Predicted Effect probably damaging
Transcript: ENSMUST00000098182
AA Change: Y57C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095784
Gene: ENSMUSG00000073931
AA Change: Y57C

DomainStartEndE-ValueType
Pfam:7tm_4 28 307 1.9e-109 PFAM
Pfam:7TM_GPCR_Srsx 32 225 6.1e-10 PFAM
Pfam:7tm_1 38 290 3.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000214099
AA Change: Y57C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 92.8%
  • 3x: 90.3%
  • 10x: 83.2%
  • 20x: 68.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T G 14: 59,142,635 L71F probably damaging Het
Adamts9 C T 6: 92,872,347 V1044I probably benign Het
Alcam T C 16: 52,295,134 Y207C probably damaging Het
Aldh4a1 C A 4: 139,642,191 S351* probably null Het
Aoah C A 13: 20,794,510 S39R probably benign Het
Arcn1 A T 9: 44,745,602 V421E possibly damaging Het
Ccdc18 A G 5: 108,158,619 E300G possibly damaging Het
Cdk2ap2 C A 19: 4,098,557 R126S probably damaging Het
Dcun1d4 A G 5: 73,510,933 I39V probably benign Het
Fam53b A T 7: 132,760,017 I94N probably damaging Het
Fam83g A G 11: 61,703,596 H652R probably damaging Het
Fanca A T 8: 123,313,064 M157K possibly damaging Het
Flt1 A T 5: 147,678,239 I299N probably damaging Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gns A G 10: 121,376,706 Y191C probably damaging Het
Grin2a T C 16: 9,644,199 T690A possibly damaging Het
Gsk3b C T 16: 38,089,401 probably benign Het
Igsf10 A G 3: 59,325,579 V1911A probably benign Het
Igsf3 A G 3: 101,427,077 K157E probably benign Het
Inpp5a T C 7: 139,511,453 Y118H probably benign Het
Kmt2a A G 9: 44,841,062 V1413A unknown Het
Mettl9 T A 7: 121,057,217 V190E probably damaging Het
Mrps9 T C 1: 42,896,098 L188P probably benign Het
Myo9a A T 9: 59,870,436 R1158S possibly damaging Het
Nacad T G 11: 6,598,621 Q1371P probably benign Het
Ncoa1 T C 12: 4,294,987 M787V probably benign Het
Noxred1 A T 12: 87,227,081 I62K probably benign Het
Olfr1390 A G 11: 49,341,399 Y289C probably damaging Het
Olfr1532-ps1 T A 7: 106,915,087 D296E possibly damaging Het
Olfr350 A T 2: 36,850,304 H86L probably benign Het
Otud6b A G 4: 14,818,185 Y239H probably damaging Het
Pank1 A G 19: 34,840,966 Y233H probably damaging Het
Pccb G T 9: 100,995,592 D286E probably benign Het
Plek A C 11: 16,990,121 L196R probably benign Het
Pou6f2 T C 13: 18,125,346 H576R Het
Rbm47 T A 5: 66,027,011 Y83F probably damaging Het
Rbm6 A T 9: 107,787,850 Y787N probably damaging Het
Slc8a2 C A 7: 16,134,494 A217E probably damaging Het
Suox G A 10: 128,671,295 A288V probably damaging Het
Tbccd1 T C 16: 22,822,123 I501M probably damaging Het
Tjp2 C A 19: 24,098,129 G1042* probably null Het
Tmtc2 T C 10: 105,413,407 Y155C probably damaging Het
Usp7 T C 16: 8,698,495 N600S probably benign Het
Zer1 T C 2: 30,101,120 I699V probably damaging Het
Zfp142 A G 1: 74,579,528 F227S probably damaging Het
Other mutations in Olfr646
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01779:Olfr646 APN 7 104106633 missense probably damaging 1.00
IGL02454:Olfr646 APN 7 104106612 missense probably damaging 0.96
IGL02588:Olfr646 APN 7 104107053 missense possibly damaging 0.94
IGL02961:Olfr646 APN 7 104107150 nonsense probably null
IGL03092:Olfr646 APN 7 104106647 missense probably damaging 0.99
R0006:Olfr646 UTSW 7 104106320 missense probably benign 0.00
R0109:Olfr646 UTSW 7 104106605 missense probably damaging 1.00
R0109:Olfr646 UTSW 7 104106605 missense probably damaging 1.00
R0601:Olfr646 UTSW 7 104107142 missense possibly damaging 0.83
R0732:Olfr646 UTSW 7 104106294 missense probably damaging 1.00
R1320:Olfr646 UTSW 7 104106480 missense probably damaging 1.00
R1468:Olfr646 UTSW 7 104106689 missense possibly damaging 0.82
R1468:Olfr646 UTSW 7 104106689 missense possibly damaging 0.82
R1513:Olfr646 UTSW 7 104106464 missense probably benign 0.02
R5486:Olfr646 UTSW 7 104106498 missense probably damaging 0.99
R6110:Olfr646 UTSW 7 104106572 missense probably damaging 1.00
R6497:Olfr646 UTSW 7 104107215 intron probably benign
R6856:Olfr646 UTSW 7 104106791 missense probably benign 0.00
R7766:Olfr646 UTSW 7 104106994 nonsense probably null
R7789:Olfr646 UTSW 7 104106988 missense probably damaging 0.99
R7844:Olfr646 UTSW 7 104106483 missense probably damaging 1.00
R7927:Olfr646 UTSW 7 104106483 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAAAGCCCTTCGTGTGCC -3'
(R):5'- TATCGATCAAAGGCCATGGC -3'

Sequencing Primer
(F):5'- TTCGTGTGCCAAGACAGAC -3'
(R):5'- GCCATGGCAAGGAGAACC -3'
Posted On2019-06-07