Incidental Mutation 'PIT4402001:Olfr1532-ps1'
ID555522
Institutional Source Beutler Lab
Gene Symbol Olfr1532-ps1
Ensembl Gene ENSMUSG00000073899
Gene Nameolfactory receptor 1532, pseudogene 1
SynonymsMOR260-9P, GA_x6K02T2PBJ9-9297671-9298594, MOR260-9P, MOR260-6P, Olfr708
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #PIT4402001 (G1)
Quality Score208.009
Status Not validated
Chromosome7
Chromosomal Location106908001-106916265 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 106915087 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 296 (D296E)
Ref Sequence ENSEMBL: ENSMUSP00000146909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098140] [ENSMUST00000207492] [ENSMUST00000215949]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098140
AA Change: D296E

PolyPhen 2 Score 0.494 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000095744
Gene: ENSMUSG00000073899
AA Change: D296E

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3.2e-58 PFAM
Pfam:7TM_GPCR_Srsx 35 285 5.6e-9 PFAM
Pfam:7tm_1 41 290 2.8e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000207492
AA Change: D296E

PolyPhen 2 Score 0.494 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215949
AA Change: D296E

PolyPhen 2 Score 0.494 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 92.8%
  • 3x: 90.3%
  • 10x: 83.2%
  • 20x: 68.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T G 14: 59,142,635 L71F probably damaging Het
Adamts9 C T 6: 92,872,347 V1044I probably benign Het
Alcam T C 16: 52,295,134 Y207C probably damaging Het
Aldh4a1 C A 4: 139,642,191 S351* probably null Het
Aoah C A 13: 20,794,510 S39R probably benign Het
Arcn1 A T 9: 44,745,602 V421E possibly damaging Het
Ccdc18 A G 5: 108,158,619 E300G possibly damaging Het
Cdk2ap2 C A 19: 4,098,557 R126S probably damaging Het
Dcun1d4 A G 5: 73,510,933 I39V probably benign Het
Fam53b A T 7: 132,760,017 I94N probably damaging Het
Fam83g A G 11: 61,703,596 H652R probably damaging Het
Fanca A T 8: 123,313,064 M157K possibly damaging Het
Flt1 A T 5: 147,678,239 I299N probably damaging Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gns A G 10: 121,376,706 Y191C probably damaging Het
Grin2a T C 16: 9,644,199 T690A possibly damaging Het
Gsk3b C T 16: 38,089,401 probably benign Het
Igsf10 A G 3: 59,325,579 V1911A probably benign Het
Igsf3 A G 3: 101,427,077 K157E probably benign Het
Inpp5a T C 7: 139,511,453 Y118H probably benign Het
Kmt2a A G 9: 44,841,062 V1413A unknown Het
Mettl9 T A 7: 121,057,217 V190E probably damaging Het
Mrps9 T C 1: 42,896,098 L188P probably benign Het
Myo9a A T 9: 59,870,436 R1158S possibly damaging Het
Nacad T G 11: 6,598,621 Q1371P probably benign Het
Ncoa1 T C 12: 4,294,987 M787V probably benign Het
Noxred1 A T 12: 87,227,081 I62K probably benign Het
Olfr1390 A G 11: 49,341,399 Y289C probably damaging Het
Olfr350 A T 2: 36,850,304 H86L probably benign Het
Olfr646 A G 7: 104,106,450 Y57C probably damaging Het
Otud6b A G 4: 14,818,185 Y239H probably damaging Het
Pank1 A G 19: 34,840,966 Y233H probably damaging Het
Pccb G T 9: 100,995,592 D286E probably benign Het
Plek A C 11: 16,990,121 L196R probably benign Het
Pou6f2 T C 13: 18,125,346 H576R Het
Rbm47 T A 5: 66,027,011 Y83F probably damaging Het
Rbm6 A T 9: 107,787,850 Y787N probably damaging Het
Slc8a2 C A 7: 16,134,494 A217E probably damaging Het
Suox G A 10: 128,671,295 A288V probably damaging Het
Tbccd1 T C 16: 22,822,123 I501M probably damaging Het
Tjp2 C A 19: 24,098,129 G1042* probably null Het
Tmtc2 T C 10: 105,413,407 Y155C probably damaging Het
Usp7 T C 16: 8,698,495 N600S probably benign Het
Zer1 T C 2: 30,101,120 I699V probably damaging Het
Zfp142 A G 1: 74,579,528 F227S probably damaging Het
Other mutations in Olfr1532-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01925:Olfr1532-ps1 APN 7 106915028 missense probably damaging 1.00
PIT4453001:Olfr1532-ps1 UTSW 7 106914929 missense probably damaging 1.00
R0008:Olfr1532-ps1 UTSW 7 106915019 missense probably benign 0.02
R0848:Olfr1532-ps1 UTSW 7 106914993 missense probably benign 0.01
R0894:Olfr1532-ps1 UTSW 7 106915110 missense probably benign 0.20
R1866:Olfr1532-ps1 UTSW 7 106915066 missense probably damaging 0.98
R1970:Olfr1532-ps1 UTSW 7 106914246 missense probably damaging 1.00
R2258:Olfr1532-ps1 UTSW 7 106914906 missense probably damaging 1.00
R7003:Olfr1532-ps1 UTSW 7 106915112 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGCTCAAGGTCTTCTCCAC -3'
(R):5'- TGTTTGCTGACACATACTTAGATGC -3'

Sequencing Primer
(F):5'- CAAGGTCTTCTCCACCTGTG -3'
(R):5'- AAAGAGCTTTGCTGTTTCTGCTC -3'
Posted On2019-06-07