Incidental Mutation 'PIT4402001:Fam53b'
ID555524
Institutional Source Beutler Lab
Gene Symbol Fam53b
Ensembl Gene ENSMUSG00000030956
Gene Namefamily with sequence similarity 53, member B
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4402001 (G1)
Quality Score154.008
Status Not validated
Chromosome7
Chromosomal Location132712082-132813886 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 132760017 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 94 (I94N)
Ref Sequence ENSEMBL: ENSMUSP00000070763 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065371] [ENSMUST00000097998] [ENSMUST00000097999] [ENSMUST00000106165] [ENSMUST00000106166] [ENSMUST00000106168] [ENSMUST00000106169] [ENSMUST00000124096] [ENSMUST00000134946]
Predicted Effect probably damaging
Transcript: ENSMUST00000065371
AA Change: I94N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070763
Gene: ENSMUSG00000030956
AA Change: I94N

DomainStartEndE-ValueType
Pfam:FAM53 1 303 6.4e-121 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097998
SMART Domains Protein: ENSMUSP00000095607
Gene: ENSMUSG00000030956

DomainStartEndE-ValueType
Pfam:FAM53 1 57 1.3e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097999
AA Change: I94N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095608
Gene: ENSMUSG00000030956
AA Change: I94N

DomainStartEndE-ValueType
Pfam:FAM53 1 303 6.4e-121 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106165
AA Change: I94N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101771
Gene: ENSMUSG00000030956
AA Change: I94N

DomainStartEndE-ValueType
Pfam:FAM53 1 303 4.2e-121 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106166
AA Change: I94N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101772
Gene: ENSMUSG00000030956
AA Change: I94N

DomainStartEndE-ValueType
Pfam:FAM53 1 303 4.2e-121 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106168
AA Change: I64N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101774
Gene: ENSMUSG00000030956
AA Change: I64N

DomainStartEndE-ValueType
Pfam:FAM53 1 273 1.2e-112 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106169
AA Change: I94N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101775
Gene: ENSMUSG00000030956
AA Change: I94N

DomainStartEndE-ValueType
Pfam:FAM53 1 303 2.3e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134946
SMART Domains Protein: ENSMUSP00000118953
Gene: ENSMUSG00000030956

DomainStartEndE-ValueType
Pfam:FAM53 1 65 1e-18 PFAM
Coding Region Coverage
  • 1x: 92.8%
  • 3x: 90.3%
  • 10x: 83.2%
  • 20x: 68.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T G 14: 59,142,635 L71F probably damaging Het
Adamts9 C T 6: 92,872,347 V1044I probably benign Het
Alcam T C 16: 52,295,134 Y207C probably damaging Het
Aldh4a1 C A 4: 139,642,191 S351* probably null Het
Aoah C A 13: 20,794,510 S39R probably benign Het
Arcn1 A T 9: 44,745,602 V421E possibly damaging Het
Ccdc18 A G 5: 108,158,619 E300G possibly damaging Het
Cdk2ap2 C A 19: 4,098,557 R126S probably damaging Het
Dcun1d4 A G 5: 73,510,933 I39V probably benign Het
Fam83g A G 11: 61,703,596 H652R probably damaging Het
Fanca A T 8: 123,313,064 M157K possibly damaging Het
Flt1 A T 5: 147,678,239 I299N probably damaging Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gns A G 10: 121,376,706 Y191C probably damaging Het
Grin2a T C 16: 9,644,199 T690A possibly damaging Het
Gsk3b C T 16: 38,089,401 probably benign Het
Igsf10 A G 3: 59,325,579 V1911A probably benign Het
Igsf3 A G 3: 101,427,077 K157E probably benign Het
Inpp5a T C 7: 139,511,453 Y118H probably benign Het
Kmt2a A G 9: 44,841,062 V1413A unknown Het
Mettl9 T A 7: 121,057,217 V190E probably damaging Het
Mrps9 T C 1: 42,896,098 L188P probably benign Het
Myo9a A T 9: 59,870,436 R1158S possibly damaging Het
Nacad T G 11: 6,598,621 Q1371P probably benign Het
Ncoa1 T C 12: 4,294,987 M787V probably benign Het
Noxred1 A T 12: 87,227,081 I62K probably benign Het
Olfr1390 A G 11: 49,341,399 Y289C probably damaging Het
Olfr1532-ps1 T A 7: 106,915,087 D296E possibly damaging Het
Olfr350 A T 2: 36,850,304 H86L probably benign Het
Olfr646 A G 7: 104,106,450 Y57C probably damaging Het
Otud6b A G 4: 14,818,185 Y239H probably damaging Het
Pank1 A G 19: 34,840,966 Y233H probably damaging Het
Pccb G T 9: 100,995,592 D286E probably benign Het
Plek A C 11: 16,990,121 L196R probably benign Het
Pou6f2 T C 13: 18,125,346 H576R Het
Rbm47 T A 5: 66,027,011 Y83F probably damaging Het
Rbm6 A T 9: 107,787,850 Y787N probably damaging Het
Slc8a2 C A 7: 16,134,494 A217E probably damaging Het
Suox G A 10: 128,671,295 A288V probably damaging Het
Tbccd1 T C 16: 22,822,123 I501M probably damaging Het
Tjp2 C A 19: 24,098,129 G1042* probably null Het
Tmtc2 T C 10: 105,413,407 Y155C probably damaging Het
Usp7 T C 16: 8,698,495 N600S probably benign Het
Zer1 T C 2: 30,101,120 I699V probably damaging Het
Zfp142 A G 1: 74,579,528 F227S probably damaging Het
Other mutations in Fam53b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01131:Fam53b APN 7 132715782 missense probably damaging 0.99
R1923:Fam53b UTSW 7 132715792 missense probably damaging 0.98
R3712:Fam53b UTSW 7 132759925 missense probably damaging 1.00
R5000:Fam53b UTSW 7 132716001 missense probably benign 0.43
R5102:Fam53b UTSW 7 132715955 nonsense probably null
R5122:Fam53b UTSW 7 132779262 start gained probably benign
R5700:Fam53b UTSW 7 132760020 missense probably damaging 1.00
R5810:Fam53b UTSW 7 132760164 missense probably damaging 1.00
R6186:Fam53b UTSW 7 132715716 missense possibly damaging 0.55
R7075:Fam53b UTSW 7 132759623 missense probably damaging 0.98
R7125:Fam53b UTSW 7 132771628 missense probably damaging 1.00
R7286:Fam53b UTSW 7 132759661 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGGAAAACTGCTCATGCGAG -3'
(R):5'- TGCTGTTGTGAAGGCCTCTC -3'

Sequencing Primer
(F):5'- TGACGCCATTGGAGTAGC -3'
(R):5'- GTTGTGAAGGCCTCTCAGATCC -3'
Posted On2019-06-07