Incidental Mutation 'PIT4402001:Rbm6'
ID555531
Institutional Source Beutler Lab
Gene Symbol Rbm6
Ensembl Gene ENSMUSG00000032582
Gene NameRNA binding motif protein 6
Synonymsg16, NY-LU-12, Def-3
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.931) question?
Stock #PIT4402001 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location107773559-107873237 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 107787850 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 787 (Y787N)
Ref Sequence ENSEMBL: ENSMUSP00000138400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035201] [ENSMUST00000181986] [ENSMUST00000183032] [ENSMUST00000195883]
Predicted Effect probably damaging
Transcript: ENSMUST00000035201
AA Change: Y655N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035201
Gene: ENSMUSG00000032582
AA Change: Y655N

DomainStartEndE-ValueType
internal_repeat_1 4 42 2.66e-5 PROSPERO
low complexity region 61 87 N/A INTRINSIC
internal_repeat_1 106 157 2.66e-5 PROSPERO
RRM 325 400 2.67e-2 SMART
Blast:ZnF_RBZ 406 430 2e-11 BLAST
RRM 522 601 1.32e-1 SMART
low complexity region 748 765 N/A INTRINSIC
ZnF_C2H2 818 843 4.34e0 SMART
low complexity region 864 876 N/A INTRINSIC
G_patch 912 958 7.87e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181986
Predicted Effect probably damaging
Transcript: ENSMUST00000183032
AA Change: Y787N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138400
Gene: ENSMUSG00000032582
AA Change: Y787N

DomainStartEndE-ValueType
internal_repeat_1 43 119 2.42e-5 PROSPERO
internal_repeat_2 46 164 3.18e-5 PROSPERO
internal_repeat_1 121 189 2.42e-5 PROSPERO
low complexity region 193 219 N/A INTRINSIC
internal_repeat_2 224 319 3.18e-5 PROSPERO
RRM 457 532 2.67e-2 SMART
Blast:ZnF_RBZ 538 562 2e-9 BLAST
RRM 654 733 1.32e-1 SMART
low complexity region 880 897 N/A INTRINSIC
ZnF_C2H2 950 975 4.34e0 SMART
low complexity region 996 1008 N/A INTRINSIC
G_patch 1044 1090 7.87e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194436
Predicted Effect probably benign
Transcript: ENSMUST00000195883
SMART Domains Protein: ENSMUSP00000141953
Gene: ENSMUSG00000032582

DomainStartEndE-ValueType
Blast:ZnF_RBZ 24 48 9e-12 BLAST
Coding Region Coverage
  • 1x: 92.8%
  • 3x: 90.3%
  • 10x: 83.2%
  • 20x: 68.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T G 14: 59,142,635 L71F probably damaging Het
Adamts9 C T 6: 92,872,347 V1044I probably benign Het
Alcam T C 16: 52,295,134 Y207C probably damaging Het
Aldh4a1 C A 4: 139,642,191 S351* probably null Het
Aoah C A 13: 20,794,510 S39R probably benign Het
Arcn1 A T 9: 44,745,602 V421E possibly damaging Het
Ccdc18 A G 5: 108,158,619 E300G possibly damaging Het
Cdk2ap2 C A 19: 4,098,557 R126S probably damaging Het
Dcun1d4 A G 5: 73,510,933 I39V probably benign Het
Fam53b A T 7: 132,760,017 I94N probably damaging Het
Fam83g A G 11: 61,703,596 H652R probably damaging Het
Fanca A T 8: 123,313,064 M157K possibly damaging Het
Flt1 A T 5: 147,678,239 I299N probably damaging Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gns A G 10: 121,376,706 Y191C probably damaging Het
Grin2a T C 16: 9,644,199 T690A possibly damaging Het
Gsk3b C T 16: 38,089,401 probably benign Het
Igsf10 A G 3: 59,325,579 V1911A probably benign Het
Igsf3 A G 3: 101,427,077 K157E probably benign Het
Inpp5a T C 7: 139,511,453 Y118H probably benign Het
Kmt2a A G 9: 44,841,062 V1413A unknown Het
Mettl9 T A 7: 121,057,217 V190E probably damaging Het
Mrps9 T C 1: 42,896,098 L188P probably benign Het
Myo9a A T 9: 59,870,436 R1158S possibly damaging Het
Nacad T G 11: 6,598,621 Q1371P probably benign Het
Ncoa1 T C 12: 4,294,987 M787V probably benign Het
Noxred1 A T 12: 87,227,081 I62K probably benign Het
Olfr1390 A G 11: 49,341,399 Y289C probably damaging Het
Olfr1532-ps1 T A 7: 106,915,087 D296E possibly damaging Het
Olfr350 A T 2: 36,850,304 H86L probably benign Het
Olfr646 A G 7: 104,106,450 Y57C probably damaging Het
Otud6b A G 4: 14,818,185 Y239H probably damaging Het
Pank1 A G 19: 34,840,966 Y233H probably damaging Het
Pccb G T 9: 100,995,592 D286E probably benign Het
Plek A C 11: 16,990,121 L196R probably benign Het
Pou6f2 T C 13: 18,125,346 H576R Het
Rbm47 T A 5: 66,027,011 Y83F probably damaging Het
Slc8a2 C A 7: 16,134,494 A217E probably damaging Het
Suox G A 10: 128,671,295 A288V probably damaging Het
Tbccd1 T C 16: 22,822,123 I501M probably damaging Het
Tjp2 C A 19: 24,098,129 G1042* probably null Het
Tmtc2 T C 10: 105,413,407 Y155C probably damaging Het
Usp7 T C 16: 8,698,495 N600S probably benign Het
Zer1 T C 2: 30,101,120 I699V probably damaging Het
Zfp142 A G 1: 74,579,528 F227S probably damaging Het
Other mutations in Rbm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Rbm6 APN 9 107788349 missense probably damaging 1.00
IGL01647:Rbm6 APN 9 107852882 missense probably benign 0.13
IGL01872:Rbm6 APN 9 107783715 missense probably damaging 0.99
IGL02402:Rbm6 APN 9 107852852 missense probably damaging 1.00
IGL03024:Rbm6 APN 9 107787368 missense probably damaging 0.97
IGL03025:Rbm6 APN 9 107774719 missense possibly damaging 0.76
FR4737:Rbm6 UTSW 9 107782755 frame shift probably null
G1Funyon:Rbm6 UTSW 9 107852794 missense probably damaging 1.00
R0511:Rbm6 UTSW 9 107847289 nonsense probably null
R1666:Rbm6 UTSW 9 107791856 missense probably benign 0.15
R1927:Rbm6 UTSW 9 107852903 missense probably damaging 1.00
R2173:Rbm6 UTSW 9 107852191 missense possibly damaging 0.79
R2262:Rbm6 UTSW 9 107791090 missense probably damaging 1.00
R2439:Rbm6 UTSW 9 107779597 missense probably damaging 1.00
R2566:Rbm6 UTSW 9 107791998 missense possibly damaging 0.60
R2878:Rbm6 UTSW 9 107852450 missense probably damaging 1.00
R4342:Rbm6 UTSW 9 107847247 intron probably benign
R4783:Rbm6 UTSW 9 107852903 missense probably damaging 1.00
R4785:Rbm6 UTSW 9 107787352 missense probably benign 0.06
R5205:Rbm6 UTSW 9 107788343 missense probably benign 0.08
R5253:Rbm6 UTSW 9 107852657 missense probably damaging 1.00
R5279:Rbm6 UTSW 9 107778014 missense probably benign 0.00
R5356:Rbm6 UTSW 9 107852666 missense probably damaging 1.00
R6289:Rbm6 UTSW 9 107777948 missense probably damaging 1.00
R6328:Rbm6 UTSW 9 107787259 missense probably benign 0.00
R6564:Rbm6 UTSW 9 107833498 missense probably damaging 1.00
R6887:Rbm6 UTSW 9 107852231 missense probably damaging 1.00
R6978:Rbm6 UTSW 9 107852575 splice site probably null
R7139:Rbm6 UTSW 9 107853211 missense probably damaging 1.00
R7240:Rbm6 UTSW 9 107852896 missense probably damaging 1.00
R7330:Rbm6 UTSW 9 107791045 missense possibly damaging 0.77
R7397:Rbm6 UTSW 9 107852519 missense probably benign
R7590:Rbm6 UTSW 9 107791750 critical splice donor site probably null
R7829:Rbm6 UTSW 9 107852706 missense probably damaging 1.00
R8301:Rbm6 UTSW 9 107852794 missense probably damaging 1.00
R8405:Rbm6 UTSW 9 107852817 missense probably benign 0.01
R8784:Rbm6 UTSW 9 107788138 missense possibly damaging 0.71
R8935:Rbm6 UTSW 9 107800746 missense probably benign 0.02
Z1191:Rbm6 UTSW 9 107777972 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCCACTTTTCAAGCAAAGAGC -3'
(R):5'- GGGCAACAGTGTAAGTAACTTG -3'

Sequencing Primer
(F):5'- GAGCATCCAGAGAATCCAGAG -3'
(R):5'- GGCAACAGTGTAAGTAACTTGTTTTG -3'
Posted On2019-06-07