Incidental Mutation 'PIT4402001:Gns'
ID555533
Institutional Source Beutler Lab
Gene Symbol Gns
Ensembl Gene ENSMUSG00000034707
Gene Nameglucosamine (N-acetyl)-6-sulfatase
SynonymsG6S, 2610016K11Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.248) question?
Stock #PIT4402001 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location121365090-121397249 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121376706 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 191 (Y191C)
Ref Sequence ENSEMBL: ENSMUSP00000043167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040344] [ENSMUST00000219249] [ENSMUST00000219505] [ENSMUST00000219851]
Predicted Effect probably damaging
Transcript: ENSMUST00000040344
AA Change: Y191C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043167
Gene: ENSMUSG00000034707
AA Change: Y191C

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Pfam:Sulfatase 39 376 1.4e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000219249
Predicted Effect probably damaging
Transcript: ENSMUST00000219505
AA Change: Y120C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000219851
Coding Region Coverage
  • 1x: 92.8%
  • 3x: 90.3%
  • 10x: 83.2%
  • 20x: 68.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a lysosomal enzyme found in all cells. It is involved in the catabolism of heparin, heparan sulphate, and keratan sulphate. Deficiency of this enzyme results in the accumulation of undegraded substrate and the lysosomal storage disorder mucopolysaccharidosis type IIID (Sanfilippo D syndrome). Mucopolysaccharidosis type IIID is the least common of the four subtypes of Sanfilippo syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous KO results in progressive lysosomal glycosaminoglycan accumulation in the central nervous system and peripheral organs and causes hypoactivity and shortened lifespan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T G 14: 59,142,635 L71F probably damaging Het
Adamts9 C T 6: 92,872,347 V1044I probably benign Het
Alcam T C 16: 52,295,134 Y207C probably damaging Het
Aldh4a1 C A 4: 139,642,191 S351* probably null Het
Aoah C A 13: 20,794,510 S39R probably benign Het
Arcn1 A T 9: 44,745,602 V421E possibly damaging Het
Ccdc18 A G 5: 108,158,619 E300G possibly damaging Het
Cdk2ap2 C A 19: 4,098,557 R126S probably damaging Het
Dcun1d4 A G 5: 73,510,933 I39V probably benign Het
Fam53b A T 7: 132,760,017 I94N probably damaging Het
Fam83g A G 11: 61,703,596 H652R probably damaging Het
Fanca A T 8: 123,313,064 M157K possibly damaging Het
Flt1 A T 5: 147,678,239 I299N probably damaging Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Grin2a T C 16: 9,644,199 T690A possibly damaging Het
Gsk3b C T 16: 38,089,401 probably benign Het
Igsf10 A G 3: 59,325,579 V1911A probably benign Het
Igsf3 A G 3: 101,427,077 K157E probably benign Het
Inpp5a T C 7: 139,511,453 Y118H probably benign Het
Kmt2a A G 9: 44,841,062 V1413A unknown Het
Mettl9 T A 7: 121,057,217 V190E probably damaging Het
Mrps9 T C 1: 42,896,098 L188P probably benign Het
Myo9a A T 9: 59,870,436 R1158S possibly damaging Het
Nacad T G 11: 6,598,621 Q1371P probably benign Het
Ncoa1 T C 12: 4,294,987 M787V probably benign Het
Noxred1 A T 12: 87,227,081 I62K probably benign Het
Olfr1390 A G 11: 49,341,399 Y289C probably damaging Het
Olfr1532-ps1 T A 7: 106,915,087 D296E possibly damaging Het
Olfr350 A T 2: 36,850,304 H86L probably benign Het
Olfr646 A G 7: 104,106,450 Y57C probably damaging Het
Otud6b A G 4: 14,818,185 Y239H probably damaging Het
Pank1 A G 19: 34,840,966 Y233H probably damaging Het
Pccb G T 9: 100,995,592 D286E probably benign Het
Plek A C 11: 16,990,121 L196R probably benign Het
Pou6f2 T C 13: 18,125,346 H576R Het
Rbm47 T A 5: 66,027,011 Y83F probably damaging Het
Rbm6 A T 9: 107,787,850 Y787N probably damaging Het
Slc8a2 C A 7: 16,134,494 A217E probably damaging Het
Suox G A 10: 128,671,295 A288V probably damaging Het
Tbccd1 T C 16: 22,822,123 I501M probably damaging Het
Tjp2 C A 19: 24,098,129 G1042* probably null Het
Tmtc2 T C 10: 105,413,407 Y155C probably damaging Het
Usp7 T C 16: 8,698,495 N600S probably benign Het
Zer1 T C 2: 30,101,120 I699V probably damaging Het
Zfp142 A G 1: 74,579,528 F227S probably damaging Het
Other mutations in Gns
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02097:Gns APN 10 121390693 missense probably benign 0.01
R0086:Gns UTSW 10 121391473 missense probably damaging 1.00
R0344:Gns UTSW 10 121383423 missense probably benign 0.04
R0544:Gns UTSW 10 121376267 nonsense probably null
R0626:Gns UTSW 10 121383444 critical splice donor site probably null
R1770:Gns UTSW 10 121378047 missense probably benign 0.00
R2142:Gns UTSW 10 121392778 missense probably damaging 1.00
R4036:Gns UTSW 10 121371190 missense probably damaging 1.00
R4451:Gns UTSW 10 121376696 missense probably damaging 1.00
R4569:Gns UTSW 10 121381178 missense probably benign 0.00
R5264:Gns UTSW 10 121380185 missense probably benign 0.12
R5467:Gns UTSW 10 121391446 missense probably benign 0.00
R7268:Gns UTSW 10 121376652 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAACCCCAGCTCAGTGTGAC -3'
(R):5'- CGTGAGTCTTGGCTCTTATACAG -3'

Sequencing Primer
(F):5'- CTCAGTGTGACACAGGCAGAC -3'
(R):5'- CTTATACAGAGAAAAACAGCCTAGAG -3'
Posted On2019-06-07