Incidental Mutation 'PIT4402001:Suox'
ID555534
Institutional Source Beutler Lab
Gene Symbol Suox
Ensembl Gene ENSMUSG00000049858
Gene Namesulfite oxidase
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.601) question?
Stock #PIT4402001 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location128669894-128674073 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 128671295 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 288 (A288V)
Ref Sequence ENSEMBL: ENSMUSP00000056195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054764]
Predicted Effect probably damaging
Transcript: ENSMUST00000054764
AA Change: A288V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056195
Gene: ENSMUSG00000049858
AA Change: A288V

DomainStartEndE-ValueType
low complexity region 58 70 N/A INTRINSIC
Cyt-b5 86 162 3.41e-13 SMART
Pfam:Oxidored_molyb 220 396 1.2e-62 PFAM
Pfam:Mo-co_dimer 418 545 1.7e-45 PFAM
Coding Region Coverage
  • 1x: 92.8%
  • 3x: 90.3%
  • 10x: 83.2%
  • 20x: 68.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfite oxidase is a homodimeric protein localized to the intermembrane space of mitochondria. Each subunit contains a heme domain and a molybdopterin-binding domain. The enzyme catalyzes the oxidation of sulfite to sulfate, the final reaction in the oxidative degradation of the sulfur amino acids cysteine and methionine. Sulfite oxidase deficiency results in neurological abnormalities which are often fatal at an early age. Alternative splicing results in multiple transcript variants encoding identical proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T G 14: 59,142,635 L71F probably damaging Het
Adamts9 C T 6: 92,872,347 V1044I probably benign Het
Alcam T C 16: 52,295,134 Y207C probably damaging Het
Aldh4a1 C A 4: 139,642,191 S351* probably null Het
Aoah C A 13: 20,794,510 S39R probably benign Het
Arcn1 A T 9: 44,745,602 V421E possibly damaging Het
Ccdc18 A G 5: 108,158,619 E300G possibly damaging Het
Cdk2ap2 C A 19: 4,098,557 R126S probably damaging Het
Dcun1d4 A G 5: 73,510,933 I39V probably benign Het
Fam53b A T 7: 132,760,017 I94N probably damaging Het
Fam83g A G 11: 61,703,596 H652R probably damaging Het
Fanca A T 8: 123,313,064 M157K possibly damaging Het
Flt1 A T 5: 147,678,239 I299N probably damaging Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gns A G 10: 121,376,706 Y191C probably damaging Het
Grin2a T C 16: 9,644,199 T690A possibly damaging Het
Gsk3b C T 16: 38,089,401 probably benign Het
Igsf10 A G 3: 59,325,579 V1911A probably benign Het
Igsf3 A G 3: 101,427,077 K157E probably benign Het
Inpp5a T C 7: 139,511,453 Y118H probably benign Het
Kmt2a A G 9: 44,841,062 V1413A unknown Het
Mettl9 T A 7: 121,057,217 V190E probably damaging Het
Mrps9 T C 1: 42,896,098 L188P probably benign Het
Myo9a A T 9: 59,870,436 R1158S possibly damaging Het
Nacad T G 11: 6,598,621 Q1371P probably benign Het
Ncoa1 T C 12: 4,294,987 M787V probably benign Het
Noxred1 A T 12: 87,227,081 I62K probably benign Het
Olfr1390 A G 11: 49,341,399 Y289C probably damaging Het
Olfr1532-ps1 T A 7: 106,915,087 D296E possibly damaging Het
Olfr350 A T 2: 36,850,304 H86L probably benign Het
Olfr646 A G 7: 104,106,450 Y57C probably damaging Het
Otud6b A G 4: 14,818,185 Y239H probably damaging Het
Pank1 A G 19: 34,840,966 Y233H probably damaging Het
Pccb G T 9: 100,995,592 D286E probably benign Het
Plek A C 11: 16,990,121 L196R probably benign Het
Pou6f2 T C 13: 18,125,346 H576R Het
Rbm47 T A 5: 66,027,011 Y83F probably damaging Het
Rbm6 A T 9: 107,787,850 Y787N probably damaging Het
Slc8a2 C A 7: 16,134,494 A217E probably damaging Het
Tbccd1 T C 16: 22,822,123 I501M probably damaging Het
Tjp2 C A 19: 24,098,129 G1042* probably null Het
Tmtc2 T C 10: 105,413,407 Y155C probably damaging Het
Usp7 T C 16: 8,698,495 N600S probably benign Het
Zer1 T C 2: 30,101,120 I699V probably damaging Het
Zfp142 A G 1: 74,579,528 F227S probably damaging Het
Other mutations in Suox
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02141:Suox APN 10 128672098 splice site probably benign
IGL02744:Suox APN 10 128671217 missense probably benign 0.00
R0414:Suox UTSW 10 128671457 missense probably benign 0.01
R0418:Suox UTSW 10 128670885 missense probably damaging 1.00
R0612:Suox UTSW 10 128670656 missense probably benign
R1845:Suox UTSW 10 128670539 missense possibly damaging 0.56
R3976:Suox UTSW 10 128671037 missense probably damaging 0.96
R4808:Suox UTSW 10 128671889 missense possibly damaging 0.81
R5098:Suox UTSW 10 128671158 missense probably damaging 1.00
R5587:Suox UTSW 10 128671825 missense probably damaging 1.00
R5721:Suox UTSW 10 128671293 missense possibly damaging 0.55
R6968:Suox UTSW 10 128671833 missense possibly damaging 0.92
R7378:Suox UTSW 10 128671041 missense probably benign 0.05
R7669:Suox UTSW 10 128670911 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CATTTCATAAGCCAGGAGGACCTC -3'
(R):5'- TCTGCCTGTACCTAACCTGG -3'

Sequencing Primer
(F):5'- ACCTCGGCTTCAGGATCCATG -3'
(R):5'- CCACACACCTATCGCTTACATGTAG -3'
Posted On2019-06-07