Incidental Mutation 'R0603:Olfr957'
ID55554
Institutional Source Beutler Lab
Gene Symbol Olfr957
Ensembl Gene ENSMUSG00000095322
Gene Nameolfactory receptor 957
SynonymsGA_x6K02T2PVTD-33208209-33207274, MOR171-12
MMRRC Submission 038792-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R0603 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location39510234-39515809 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 39511514 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 69 (V69F)
Ref Sequence ENSEMBL: ENSMUSP00000149559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051653] [ENSMUST00000216177]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051653
AA Change: V69F

PolyPhen 2 Score 0.758 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000054536
Gene: ENSMUSG00000095322
AA Change: V69F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.8e-50 PFAM
Pfam:7tm_1 41 290 3.8e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216177
AA Change: V69F

PolyPhen 2 Score 0.758 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc7 A G 5: 122,440,170 N406S probably benign Het
Arhgap4 C T X: 73,906,783 R54Q probably damaging Het
Asb15 T A 6: 24,556,557 I17N probably damaging Het
Atp8a1 T C 5: 67,756,696 probably null Het
Caprin1 A G 2: 103,796,801 V47A probably benign Het
Col4a2 T C 8: 11,414,779 V348A probably benign Het
Disp2 A G 2: 118,792,006 K1073R probably damaging Het
Dmxl2 G A 9: 54,405,906 H1686Y possibly damaging Het
Dzank1 C T 2: 144,511,512 V152I probably benign Het
Evl T A 12: 108,648,422 I25N probably damaging Het
Fam117a A G 11: 95,380,873 K424E probably damaging Het
Gm17732 C T 18: 62,662,752 probably benign Het
Gpr158 T C 2: 21,815,669 I659T possibly damaging Het
Hectd4 T A 5: 121,304,337 V1280E possibly damaging Het
Ikbkap A T 4: 56,792,105 I221N possibly damaging Het
Irs4 T C X: 141,725,075 T42A probably damaging Het
Kdm4a C T 4: 118,142,511 V905I probably damaging Het
Lmtk3 T A 7: 45,795,556 probably benign Het
Lsp1 G A 7: 142,489,378 R221H probably damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mut A T 17: 40,947,166 I408F probably damaging Het
Nckap1 A T 2: 80,512,729 V942E probably benign Het
Neto1 T A 18: 86,473,660 C229S possibly damaging Het
Nipal2 A G 15: 34,650,398 I63T probably damaging Het
Olfr1299 A T 2: 111,664,880 Y218F probably damaging Het
Olfr366 G A 2: 37,220,106 V206I probably damaging Het
Olfr58 A T 9: 19,783,939 R269W probably damaging Het
Olfr744 T C 14: 50,618,510 I96T probably damaging Het
Pgpep1 T C 8: 70,650,633 E120G probably benign Het
Pkhd1 A T 1: 20,117,173 M3637K probably benign Het
Pkm T C 9: 59,665,881 V58A probably damaging Het
Ppp2r1b C A 9: 50,861,685 T154K probably damaging Het
Rgs18 T A 1: 144,756,080 D98V possibly damaging Het
Rsph6a G T 7: 19,065,961 A506S possibly damaging Het
Selenop T A 15: 3,275,701 V113E probably damaging Het
Slc6a11 G A 6: 114,244,890 V514M probably benign Het
Srsf9 C T 5: 115,332,637 S132L probably damaging Het
Tchh G A 3: 93,443,781 R176H possibly damaging Het
Tcp11 T C 17: 28,067,810 N405S probably damaging Het
Tle1 A C 4: 72,118,347 D760E probably damaging Het
Tmem178 A G 17: 80,945,059 D124G possibly damaging Het
Trabd G A 15: 89,082,726 E118K probably damaging Het
Ttc39a A G 4: 109,426,302 D115G probably damaging Het
Uaca T A 9: 60,871,097 M920K possibly damaging Het
Uba2 A T 7: 34,161,613 M5K probably damaging Het
Unc5c C T 3: 141,771,102 P343L probably damaging Het
Wdhd1 T C 14: 47,263,586 D453G probably damaging Het
Wfdc8 A G 2: 164,603,225 Y157H probably damaging Het
Zbbx T G 3: 75,078,450 K432Q probably benign Het
Zeb2 G A 2: 45,017,426 T169M probably benign Het
Zfp956 A G 6: 47,956,028 E79G probably damaging Het
Zzef1 G A 11: 72,818,069 V165I probably benign Het
Other mutations in Olfr957
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01520:Olfr957 APN 9 39511046 missense possibly damaging 0.64
R1642:Olfr957 UTSW 9 39511354 missense possibly damaging 0.78
R2044:Olfr957 UTSW 9 39511378 missense probably damaging 0.99
R2182:Olfr957 UTSW 9 39511426 missense probably damaging 1.00
R2290:Olfr957 UTSW 9 39511678 missense possibly damaging 0.87
R4246:Olfr957 UTSW 9 39511603 missense probably benign 0.31
R4248:Olfr957 UTSW 9 39511603 missense probably benign 0.31
R5273:Olfr957 UTSW 9 39511499 missense possibly damaging 0.95
R5495:Olfr957 UTSW 9 39511145 missense probably benign 0.39
R5718:Olfr957 UTSW 9 39511042 missense probably damaging 1.00
R5827:Olfr957 UTSW 9 39511058 missense probably damaging 1.00
R6261:Olfr957 UTSW 9 39510809 missense probably benign
R6917:Olfr957 UTSW 9 39511199 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGACAGCCAGCATGTGACACTCC -3'
(R):5'- TGGGTCCCAGGGCTATGACTATTG -3'

Sequencing Primer
(F):5'- GCATGTGACACTCCGAAACAG -3'
(R):5'- GTCCCAGGGCTATGACTATTGATAAG -3'
Posted On2013-07-11