Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4402001:Grin2a'

555545

Institutional Source

Beutler Lab

Gene Symbol

Grin2a

Ensembl Gene

ENSMUSG00000059003

Gene Name

glutamate receptor, ionotropic, NMDA2A (epsilon 1)

Synonyms

NR2A, GluRepsilon1, NMDAR2A, GluN2A

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.531) question?

Stock #

PIT4402001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

9567898-9995560 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 9644199 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 690 (T690A)

Ref Sequence

ENSEMBL: ENSMUSP00000032331 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032331] [ENSMUST00000115835] [ENSMUST00000199708]

AlphaFold

P35436

Predicted Effect

possibly damaging
Transcript: ENSMUST00000032331
AA Change: T690A

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000032331
Gene: ENSMUSG00000059003
AA Change: T690A

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:ANF_receptor	106	301	1.6e-10	PFAM
PBPe	431	798	1.68e-70	SMART
Lig_chan-Glu_bd	439	502	2.24e-22	SMART
transmembrane domain	818	837	N/A	INTRINSIC
Pfam:NMDAR2_C	839	1464	2.1e-230	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115835
AA Change: T690A

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000111501
Gene: ENSMUSG00000059003
AA Change: T690A

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:ANF_receptor	99	300	9.2e-11	PFAM
PBPe	431	798	1.68e-70	SMART
Lig_chan-Glu_bd	439	502	2.24e-22	SMART
transmembrane domain	818	837	N/A	INTRINSIC
Pfam:NMDAR2_C	839	1464	1.2e-266	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000199708
AA Change: T690A

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000142900
Gene: ENSMUSG00000059003
AA Change: T690A

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:ANF_receptor	106	301	1.6e-10	PFAM
PBPe	431	798	1.68e-70	SMART
Lig_chan-Glu_bd	439	502	2.24e-22	SMART
transmembrane domain	818	837	N/A	INTRINSIC
Pfam:NMDAR2_C	839	1464	2.1e-230	PFAM

Coding Region Coverage

1x: 92.8%
3x: 90.3%
10x: 83.2%
20x: 68.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glutamate-gated ion channel protein family. The encoded protein is an N-methyl-D-aspartate (NMDA) receptor subunit. NMDA receptors are both ligand-gated and voltage-dependent, and are involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. These receptors are permeable to calcium ions, and activation results in a calcium influx into post-synaptic cells, which results in the activation of several signaling cascades. Disruption of this gene is associated with focal epilepsy and speech disorder with or without mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit jumpiness, mildly impaired long-term potentiation and spatial learning, increased locomotor activity and metabolism of dopamine and serotonin, and loss of analgesic tolerance after repeated morphine doses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700129C05Rik	T	G	14: 59,142,635	L71F	probably damaging	Het
Adamts9	C	T	6: 92,872,347	V1044I	probably benign	Het
Alcam	T	C	16: 52,295,134	Y207C	probably damaging	Het
Aldh4a1	C	A	4: 139,642,191	S351*	probably null	Het
Aoah	C	A	13: 20,794,510	S39R	probably benign	Het
Arcn1	A	T	9: 44,745,602	V421E	possibly damaging	Het
Ccdc18	A	G	5: 108,158,619	E300G	possibly damaging	Het
Cdk2ap2	C	A	19: 4,098,557	R126S	probably damaging	Het
Dcun1d4	A	G	5: 73,510,933	I39V	probably benign	Het
Fam53b	A	T	7: 132,760,017	I94N	probably damaging	Het
Fam83g	A	G	11: 61,703,596	H652R	probably damaging	Het
Fanca	A	T	8: 123,313,064	M157K	possibly damaging	Het
Flt1	A	T	5: 147,678,239	I299N	probably damaging	Het
Gm10800	CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA	CAAGAAAACTGAAAATCA	2: 98,667,016		probably null	Het
Gns	A	G	10: 121,376,706	Y191C	probably damaging	Het
Gsk3b	C	T	16: 38,089,401		probably benign	Het
Igsf10	A	G	3: 59,325,579	V1911A	probably benign	Het
Igsf3	A	G	3: 101,427,077	K157E	probably benign	Het
Inpp5a	T	C	7: 139,511,453	Y118H	probably benign	Het
Kmt2a	A	G	9: 44,841,062	V1413A	unknown	Het
Mettl9	T	A	7: 121,057,217	V190E	probably damaging	Het
Mrps9	T	C	1: 42,896,098	L188P	probably benign	Het
Myo9a	A	T	9: 59,870,436	R1158S	possibly damaging	Het
Nacad	T	G	11: 6,598,621	Q1371P	probably benign	Het
Ncoa1	T	C	12: 4,294,987	M787V	probably benign	Het
Noxred1	A	T	12: 87,227,081	I62K	probably benign	Het
Olfr1390	A	G	11: 49,341,399	Y289C	probably damaging	Het
Olfr1532-ps1	T	A	7: 106,915,087	D296E	possibly damaging	Het
Olfr350	A	T	2: 36,850,304	H86L	probably benign	Het
Olfr646	A	G	7: 104,106,450	Y57C	probably damaging	Het
Otud6b	A	G	4: 14,818,185	Y239H	probably damaging	Het
Pank1	A	G	19: 34,840,966	Y233H	probably damaging	Het
Pccb	G	T	9: 100,995,592	D286E	probably benign	Het
Plek	A	C	11: 16,990,121	L196R	probably benign	Het
Pou6f2	T	C	13: 18,125,346	H576R		Het
Rbm47	T	A	5: 66,027,011	Y83F	probably damaging	Het
Rbm6	A	T	9: 107,787,850	Y787N	probably damaging	Het
Slc8a2	C	A	7: 16,134,494	A217E	probably damaging	Het
Suox	G	A	10: 128,671,295	A288V	probably damaging	Het
Tbccd1	T	C	16: 22,822,123	I501M	probably damaging	Het
Tjp2	C	A	19: 24,098,129	G1042*	probably null	Het
Tmtc2	T	C	10: 105,413,407	Y155C	probably damaging	Het
Usp7	T	C	16: 8,698,495	N600S	probably benign	Het
Zer1	T	C	2: 30,101,120	I699V	probably damaging	Het
Zfp142	A	G	1: 74,579,528	F227S	probably damaging	Het

Other mutations in Grin2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01777:Grin2a	APN	16	9644130	missense	probably benign	0.29
IGL03288:Grin2a	APN	16	9669840	missense	possibly damaging	0.85
IGL02796:Grin2a	UTSW	16	9585108	missense	possibly damaging	0.72
PIT4494001:Grin2a	UTSW	16	9585096	missense	probably damaging	0.98
R0055:Grin2a	UTSW	16	9669807	missense	probably damaging	0.99
R0055:Grin2a	UTSW	16	9669807	missense	probably damaging	0.99
R0164:Grin2a	UTSW	16	9994821	critical splice donor site	probably null
R0164:Grin2a	UTSW	16	9994821	critical splice donor site	probably null
R0211:Grin2a	UTSW	16	9579173	missense	possibly damaging	0.86
R0390:Grin2a	UTSW	16	9579585	missense	possibly damaging	0.85
R0659:Grin2a	UTSW	16	9992472	missense	probably damaging	0.98
R0661:Grin2a	UTSW	16	9992472	missense	probably damaging	0.98
R0734:Grin2a	UTSW	16	9579611	missense	possibly damaging	0.71
R1524:Grin2a	UTSW	16	9663603	missense	possibly damaging	0.55
R1542:Grin2a	UTSW	16	9579203	missense	probably damaging	0.98
R1556:Grin2a	UTSW	16	9707715	missense	probably benign	0.18
R1605:Grin2a	UTSW	16	9663330	missense	possibly damaging	0.46
R1792:Grin2a	UTSW	16	9992395	missense	possibly damaging	0.53
R2024:Grin2a	UTSW	16	9644243	missense	possibly damaging	0.76
R2057:Grin2a	UTSW	16	9669744	missense	probably benign	0.14
R2344:Grin2a	UTSW	16	9663235	missense	probably benign	0.03
R2847:Grin2a	UTSW	16	9761965	missense	possibly damaging	0.73
R2848:Grin2a	UTSW	16	9761965	missense	possibly damaging	0.73
R2981:Grin2a	UTSW	16	9644223	missense	possibly damaging	0.89
R4197:Grin2a	UTSW	16	9761967	missense	probably damaging	1.00
R4342:Grin2a	UTSW	16	9653589	missense	possibly damaging	0.52
R4741:Grin2a	UTSW	16	9663512	missense	probably damaging	1.00
R4891:Grin2a	UTSW	16	9657706	missense	possibly damaging	0.51
R4925:Grin2a	UTSW	16	9669823	missense	probably damaging	0.98
R5563:Grin2a	UTSW	16	9707717	missense	probably benign	0.18
R5645:Grin2a	UTSW	16	9992226	missense	probably damaging	0.98
R5769:Grin2a	UTSW	16	9761526	missense	possibly damaging	0.89
R5885:Grin2a	UTSW	16	9761905	missense	possibly damaging	0.95
R6065:Grin2a	UTSW	16	9761907	missense	possibly damaging	0.92
R6083:Grin2a	UTSW	16	9579540	missense	probably benign	0.02
R6137:Grin2a	UTSW	16	9653449	missense	probably benign	0.32
R6286:Grin2a	UTSW	16	9761775	missense	possibly damaging	0.93
R6342:Grin2a	UTSW	16	9579334	missense	probably damaging	0.98
R6697:Grin2a	UTSW	16	9669840	missense	possibly damaging	0.85
R6924:Grin2a	UTSW	16	9663228	missense	possibly damaging	0.71
R7070:Grin2a	UTSW	16	9579424	missense	possibly damaging	0.92
R7235:Grin2a	UTSW	16	9579265	missense	probably damaging	0.98
R7274:Grin2a	UTSW	16	9579122	missense	possibly damaging	0.71
R7669:Grin2a	UTSW	16	9992463	missense	probably benign
R7990:Grin2a	UTSW	16	9579176	missense	possibly damaging	0.71
R8261:Grin2a	UTSW	16	9663518	missense	probably damaging	0.97
R8503:Grin2a	UTSW	16	9663549	missense	probably damaging	0.97
R8679:Grin2a	UTSW	16	9585225	missense	possibly damaging	0.90
R8700:Grin2a	UTSW	16	9579548	missense	probably benign	0.32
R8823:Grin2a	UTSW	16	9669894	missense	possibly damaging	0.96
R9122:Grin2a	UTSW	16	9579322	missense	possibly damaging	0.93
R9656:Grin2a	UTSW	16	9579607	missense	possibly damaging	0.71
R9674:Grin2a	UTSW	16	9653401	nonsense	probably null
R9786:Grin2a	UTSW	16	9653602	missense	possibly damaging	0.71
X0024:Grin2a	UTSW	16	9663199	missense	probably benign	0.36
Z1177:Grin2a	UTSW	16	9663577	missense	possibly damaging	0.74

Predicted Primers

PCR Primer
(F):5'- AGCCATGCAGAGTCTGTTTC -3'
(R):5'- GCCATCTTAGAGATCGCAGACC -3'

Sequencing Primer
(F):5'- CTGTCAGATTTAAAGACCCGATGTC -3'
(R):5'- TCTTAGAGATCGCAGACCCATGG -3'

Posted On

2019-06-07